Open Close
General Information
Symbol
Dmel\CG32982-RE
Species
D. melanogaster
Annotation Symbol
CG32982-RE
FlyBase ID
FBtr0301040
Feature type
Associated gene
Evidence Rank
Length (nt)
3397
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 32 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CCAGTCATCGACGGGCAGCTCGCGTGGATAGTTCGCCTTCGCTTCGGTCGCTCGTTTGCTTTGCGCGACCAACTCACTTT
        GAAAATAAAATTTTGGCCAATAACAAAATTGGTTTTTTCAATTTGCTAAGCCACAGCCGCACCGAGAAACCGCAAAGAAA
        TGCGACGCGACACGCTGCCAACAAATTAAATTTAACCTAAAGAAATACGATTTCAGAACCAAACCAACCCAAGTGTGTAA
        CAAGAGCCGACTTTGAGTAACAATTAGCAAAAGTACAGAACTAATGGAAGCCACTATTTAATTCTCCACCCACAGTCAAC
        TCGAAAAGTGCAACATTCCCCATAAATAATAAGCAAGCGTTGCAGTTAACTTACCGCTAAAATCAACGATCCAACAATCA
        AGCAAAAAAAAAAACAAAAGAAAAACCATCAACGTAGGCTAAGAAACAGAACGGAAAATGCTCATGCACACAACATCAAT
        TTCCACAACGTCGACGGCCACCATGACCAACTCATCGTCCTCCGCCACGCCCACACCCGGGTCGACTTCCTCCAACAACA
        GTGCCACGCTCGACGCGCTGCACCAGCAACAACAGCAGCAGCACCAGCAGCATCAGCTGCAGCAACAACTGCAGCAGTTG
        CACACGAACGCCGCAAACAATTCACGGCCCCCCTCACGTGCCCCCTCCATTCTGGACAGTCCGACCCTGGCGCGTGTGGA
        GCGGGCTCGTCTGCGACTGGAGCAGCAGGAGCGGGAGCGGGAACGGGAGCGTAGCAGCCAGCGGGAGGTGGGCGGCGGCA
        GCGGAGGAGGCGGCGGCGGTGGTAGCAGCACTGGCACTGGCAGCACCGCCACAACCATGAATCGTGAGGATAGCCTGGAG
        CGCAGTATTTTGGATCCCAAGAAAGAAACGGCGCCCTGGCATCAGATGTGGACGCACATGAAACGCCTCTCGCACGCCTC
        CAAAGTCAATTCGACGAGCAGTCTGACCGCCCAGAAAACCGATGTGGGCGTGGGCCATCATCCAAACATGACACCAAATG
        CAACAGCAACAACAACGGCAACGGGAACAATGACATCAACGCCCGGAAAATGCATTCTATTTCCGGATAAGACGGCCTCC
        CTGAAAAGCTCTATGTATACGCAACAGGTGTACTTCAGGCCCGATATGGTGAGTTGCAACAAACAAACCAATTGGCTGAA
        TTTCAAACAAGACCAATCCTTGCTGGCAGGACGCATTCCGGTGGCCTCCATGACAGGACCCATTAAACGCGGACTGCTCT
        GGCAGCAAAGGGATCGGCTCTTCTCTCGCTGGAAGGAGCGATACTTTGTGCTCACTCGTGACTACTTGCACTGCTTCAAA
        AGAGCCTCGGGATCGGCCAATGAACGTGCCTCGGATATGGGACAGTTTATCTTCAAGGTCAAGCTGGTGGACGTGGAGAA
        GGTGGAGTGGCTGAATCGGCGCTCCTACAGCGCCATTGGTCTGCTACTGGGTCGCGAGGGTCGTGTTCTACTCCGCTGCG
        ATGATGGCCTCGAGGATTGGTTCGAGCTGCTGGAGGAATGCACAATGACCTCCAAGGAGCGCAGACGAGCCCTGAAGATT
        GCCCAAGGACCCAGATCCCGAGCCTCATTGGCTGCTCCCGTTTCGCATGCTTCGCTGCAGTTCCAGCATTTTGGACTCGG
        AGGCACTTACTCGAGTGCCCTGGACGATTGGCTGATGACGAATGGAACCGGTGGTCTGGCCCGGCACAAGATTGGAGCTG
        GCAGTCTGAACGGTTATGGCGGGGCCAATCCCTTCCTGTTCTCCGATTCGGTGCCGGATCTGAGTGCCCTGAACAACGAA
        AACCACAATCATCACCTGAGCGGCATCAGCACGAACCACTCGACGCCGCAAAAGATACCGCACCACAGCAATGCGAATCT
        CAGTCGATACTCCAATGGATATGTCTCGGCCCAGAACAGTTTCACCCAAGCCGGAGCACTCTACGGATCGCCTAGGCGGA
        TCTTTATCAACAGCAGCTTCGGTTCCAATCAGGTGGTGGATGAGGAGACCGAGGAGACGGAGGTTCAGCTGAGGAGACCC
        AGACTGTTCCGGGGAGTTAGCGCTACTCCGGATAATGGCAACGAACTGGACCGCGATTGGCTGTACCGGAAGCCAAGGGC
        GCCCACTGATATGAGGCACTCAGTTCAACCAATGTTACCCACTGGCGGCGGCAGCAACATCGGGCTGGCCAAAACCGAAC
        TGGACTGTTCGGCCCATGATAGTGGCCTGGACACGCCCCCATCGACGCACCGCCCCTCGAGCTACCGGGAGGCGAGCAGG
        GACAGCACAGAGACCAATGGCAGTTCGTCGAGGGGAACACTGCTGAATAACTCATCGCCAGGCGGCAGTTTTCGAGCCAA
        AAAGCTGAGCACCCAAGTAAGCAATCTCAATCAGTTGAATTCCCTGAACGGATCGAGATACTCGGTGCAGGATCAACGCA
        TCTTGAAGATGCGCAACAACGAGGAGGATCGCTGTGCCTCCATCAAGATGGCCAATCGTCTCAATCAGAATCAGGAGCAG
        GCCACTTACGATCCCAACCAGAATCGCTACTATAAGAACGGTAATGCCACGCCCCCCACATCACTGACGCCACAGCATAC
        GCCGCAGCACAAACTGACGATGATGCACTATGGCAATGGGAATGGGAACATGGGCACCCTGAATGGCAACACCAACGGAT
        CGGATCGCATAAACGGATCGGCCATTTTCCGGGAGCGCTACCAACATCCCGCCCTGGCCGCCATCATCAACGAAGCCCAG
        GGCCTTAAGTTTCGAGAAGAATCAGAAAATATGTGGTAAACATACCCAAAGCCCCAAATTGTGCATGTTACACAAAGTGT
        CCAGCCGACTGGCCCCATAGTGCATGAGAAGATCGTGATGTTGAATGGACCAAAAGATATAGATAAAGCGATCCTTTCCC
        CAACTTGTAGAGCGGGCCTATTCGGACAGTCAGCAGCGTCGCCTCAACAACAACAATGGACCGACTCCCCAACCAGCCTC
        GCCACTCGCCCAGCGCCGGAATAATGGTGGACTCGGATCCGGAGTCGGATCGGGGGCTATATATGGCACGCCCACGCGTG
        TATAGCGCCTAAAGGTCTAAAGATAATCCAAATCGATGGAGAATTGATTGCTCCCCCACTAGTTTAATAATGATATAAAT
        TAGTCGGTAAATTAGTCGACTTGATACAAAGTTTTGGAAATTATTTGCATAGAAAATACTTCAACGAAGGTAGAGAATAG
        TAACTAAATCTTAACTATGTAGTAGTACTCGTAGTGTGTGTGCTCCAATGTCCAGCTTTATGTAAATGTTTAAATAAAAT
        ATACATTAGTAAAAAGCATCTTAATAAAAGATAAAAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0079771
        2761
        FBtr0110960
        2426
        FBtr0301039
        3241
        FBtr0303888
        2931
        FBtr0330218
        2766
        FBtr0330219
        2682
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0290262
        793
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0079372
        715
        FBpp0110260
        550
        FBpp0290261
        778
        FBpp0292891
        730
        FBpp0303251
        720
        FBpp0303252
        687
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG32982-RE
        Secondary FlyBase IDs
          References (0)