Open Close
General Information
Symbol
Dmel\CG42541-RC
Species
D. melanogaster
Annotation Symbol
CG42541-RC
FlyBase ID
FBtr0301099
Feature type
Associated gene
Evidence Rank
Length (nt)
6157
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    TTAACATATCAGTTAAAACATATGTACTTACGAAAATATAAAGTGAATACCATCCGAATTGAAAGGAAATCTTGAAAATC
    GTTGTCAAATTTACAATCAGTGTTAAACAACGGAAGGAAGGAAATCCAGGCATTGAGAGGATTCTGAAATCAAAAACACA
    TCTGAATTTAAGTTTACCATCATCTGAATTTAACTTAACATCAAGTAGCAAATATCAAATATATATAATCACTATAATAA
    ATTACATATTTAGTGTGAATCGCATATTTAATCCCAAATCTATATATCTTAATCTTAATCAAAATCTGTACGATCAAGAG
    TGTCAAAAGCATAAATCTAAGAGTGCAATCAACTTGATTGAGACTAGAAAACCTATATCGAGCTATGTAATAATATCAAG
    ATTTTAGACAAGTCTAAGTGAACACAAGTTTATTGTTCTGTACAATCTGTTTCTTAATACACCATAATCGAATATAACCG
    AATAGTCTTAACAAACCCATTGAGAAAAGCTATTGAAAGTACGCTGAATATTATTAAGAACACTAAGAACCATTGATATA
    AATGAACATACAAGAAGAGCTTAAAAATGCATCCCATACTTGATCGTTACTATAGCGATCGATATCAGATCAAGCTTATA
    ACCCGATATTTGATCGAACTCCTTCGATTGCGAAAGAAAACAAAGCGCACTTCCGAATTATCGGAGTAAAGAACTGAACT
    GAAAAAAAAAAAAATAAAAATATAACAAGCCATCGTTTTTAAAACCCGGTTTCAAGACACCTCATAAAGAGTCCAAATTG
    AACCATATCGAACTCAAAACCGAACTTATGATATAAACTGTATTCCCGAAATTGAGAACATTGAAATCGCGGTCGCAGTT
    CGCTACATCAAACCGATGTAGTTCCATTGATGCTTTGCAACCGGAGCGCTCATTCCAAGCCGAATATATTCATCATGAGT
    GTCCAGGGCCGCCCAGGATATGTGATCACATAAGGACAACGCCAAGTCGCAGTTGTTCATAAAAGAAAAAATTGAAGAAA
    AAAACAGAGGGATAGAGTGAGAAGGAGAAAGAAAAAATATATAAAAAAATAAATTGAGCAGAGTTGTTGACGCGACATGG
    ATACCAAGTTGGAGGCACGTGGCCAGTTTCCGGCCTCGTTTCCGGACACATTCAAGAACTTCTTTGCCATGATGAACGAA
    GACGAGGATCATGTGGGTCTCTTTGCCAATCTGCTGGAGGATAAGGTGATTCCGCGCCAGAACAGCCCCGTGCAGCCCCA
    GCGGCAGCGGTACGGTGGCAGCATGCGGAGTCACAGCGGCGGCGACCGCTCCGATCGAAGGGGTCGCACCGAGCGGCAGT
    ACCAGCAGCAGATCCAGAATCATCATCATCATCATCAGCAGCAGCAGCAGCAACAGCAGCAGCATCAGCAGCAGCAGCAA
    CACCAAGGCGCCCAACAGCAGCGCGTCTTTCAGTCGCGCAGTCGCAGCGGCAGTGGCAGCAGCGTTGACCTTTATGCGAA
    TCGCAATGTAAGTTTCTCGACCACCACCAACCGGGTCAATTCATTGCGGAGGAATCGCTCGCGAGGATCGCTGACCACTC
    TGAGTAGCAATGGCTTAAATGCCCTGGGCCTGGGACCCGTGACCCTTGCACCGAATGTCAGCTCGAGCAGCAGTGGCAGC
    GTCCTGGACTTGACCTTGCCTGGTGGCACTGGCACTGGAACTGTGGACGGAGGTGGCGGCGGCGGTGGTGGCGGAGCTGG
    ATGCGGTGGCCAGAACGTGTATCCTTCGCCCGCAAAGTCAAACCTGAAGCCCGCTCTGAAGGCGACCAACTCGTCGGTGG
    ATCGTGGATGCGCACTCTTCGTTGGAGTCGATGGTGAATTTCATTGCGGTCACATCAAGTACTGTTCCCTGCACCATGAC
    AATTTCGCAGATGGCCTCCAACAGCTCCAGCAGCAGCTCAAGAATCAGCAACTCGGCTCTGGACAGAAACACGTAACTAT
    GGCCTGTTGCGAGTGCGTTTGCGGCAGTGGCAAGGCTGCCCGTTCTGGACCCGATGGCGAGGACAATTGTGGGGCGAACT
    ACCTGAAGGGCTATTCTGGTGGATATATGCTACCACCGACGCCGAAGGGAAAGTCCATCGACAAGACGAGCACCTTCACT
    TCCGCCGAGCTGGCAGCCTCGAAGAACAAGGATCTGCAGGAGCGACAGGAGCGGCAGGAGAAACGTGGGTCGGTCATCCT
    CGAAAGGGCCTTCGATTTCGATGCCAGCTGCGACGAGAGCGACAGCATAAGCAGCAGCACCCACAATCCCGTGCCCTCGC
    CGGCTCCGCACCAGCTGGCCTACAATGTCCTCAAGCCGATCCTCAAGCAGCCGCAGCAGCAGCAGCAGCAGAAGGCAATG
    CTGCAGGCGCAACATCAACAGGTAAATGTACAGCAACATCAAGGAGTTACGCAGCAGCAATATCAACAGGCGACGCATCA
    ACAACTGGGCAACCAGCAGCATCAAGTGGTGACCCATCAGCCCCATCAACAGGTAACCCACCAGCAACATCCAGGCGGAG
    GTGTCCACCAGCAGCACCAAGTGATGGTTGCTCATCAGGCACACGCCCATACACAGGTTAGCAACCAGCAGCCCGTGCTG
    CAGGTTCAGCTACCGACACCCGGGGTGCACGTGGTGCACCGCCTGCTGCCCACACCGCCCACCCATAGTGGCAAGGGGGC
    GTACCACACGCGTGAGACGGCCTTGCAGCGGGTGCAACAGCAGAGTGGCTATTACAACCAGGGGCCGAGCACCTCGGCAT
    CTGCATACGGCTATAACCAGGCCATGGAACAACAGCAGATGCAGCAGCAGCTGCACTACGATCCGCATCAGGAGCTGCAG
    TTCGAGCAGCATCAGCCGCACCAGTCGCATCAGCAGCAGCAGCTGCAGCATCAGCAGCAGCATCAGCTGCAACATCAGCA
    GCAACATCAGCAGCAGCAGCAGTATCAGCAGCAGCAGCACCAGCAGCAGCAGCATCAGCAGTACGCTGATGACACCGAGC
    TTGATTACGATACGGAGTGGGAGTTGGATGAGGAACCTGCTCCTCAGATTGTACCGCCACTCACCACCTTCAACGATTTC
    GTCAATGCGGCTCAAAATCCAACTGGCAGTCGTCAGAGTCTGCGTGCCCAGAAGTCGCCGATTTTGAACAGACGTCGCGC
    CTCATCTATAGCCGGAAATCTTTTGCACTCGGATTACACGTACACCCGGAATAGCATCGGTGGAGCTCCAATCGACTCCA
    ATGATTTTCAGCGCATTTCGCACAGCAGCAGTGCCAGGGATCGCATGTCACTAGCCGGAGTCCTGACCTTTCAGCAGGCC
    ATATCTGGAGCTGTGTCACCACAGTATGGCACAGTGGGATCGCTAAATTCCCAGGTACCCGCTACCGGTGAAGCCGGAAA
    GCCGGGAATTGTGGGATCCGATGGCATTGGCGGTGGCGGTGGCGGTTTACCTGGCGGATCTTCACACAACTTAAATTTGA
    CGGTGGGCCTGGGGTTTCTCGGTGGTTCCAGCACCACTTTGGCTGCTGTCGCCGAGGTGACTAGTGGACCGGATGGCAAT
    GGCGACTCCACCGACTCCCCATCTCCGGTCTCCATGATTCCCAGCAATCAGCAAAAGCAGCAGCAGCAACTGTTGCAGTT
    GCAACTGCAGCAGGAGCAACAGCATCTGCCCACCCATTTGCCCATGAAGCGGGAACGAGGCGTAGGCGAGTCCTCGGGGG
    CCAGCACATCCGGCACCGCCATCGCCGAACTGGCCTCCTCCGTCGTCCTGGCCACCCAGTCCGGCAAGCCGATGACGGAG
    CGACAACGCTTAAGGACATCCAGCATGCCGGCGGAGAGTAGAAGGCCCCGCCTGGCGGAGATGCGACGTTCGGCCATCCA
    TGCCGGTGATCCGGACATGACCTACTACCGTCTGCGAAGCTTCAGCATCACCTCCCATGGCATCTGCAATTTGGGCGATT
    CCCTGAGAAGCCGCAGGTCACGTTCGATCAACTCCGTGACTTCCACCGGCACCTCAAACAGCGGCGTGGATCGACACAAT
    AGCAACGCATCGGGGGCATCGGGCGAAGTCATCGACGGGGATCCCAATGTTCCAGCCTACAAAATTGCCATGCTCGGCGC
    CTCCGGAGTGGGCAAGACCACACTGACTTACCAGTTCACCACTTCCGATTACATATGCGCCTACGACCTGAGTCTCGATG
    ATGACTACGGACAGAAGACGGTGTCGGTGCTGGTCGATAACATTGAGACGGATTTGGAGATTATTGATCATCCCGCATGC
    GAGATGTCGACGGAGGCCTTCTGCGCCACCTACAACATCGACCTCTTCGTGGTGGTCTACTCTGTGATAGATCGAAACAC
    TTTCGCAGCAGCCGAGCGTGTCCTGCAGTATCTCAAGGAGAACGAGATGCTCTTGTCCCGCGGAGCCATCCTGGTGGCCA
    ACAAAACGGATCTGCAGCGACACCGAGTTGTCACCCGTCAGATGGGTCGCAAGGTGGCCAAGGAAATAGCGTGCAAGTTT
    ATCGAGACGTCCTCGGGACTGGATCACAATGTGGACGAGCTGCTGGTCGGCATTGTGGCCCAGGTGAAACTCAATCCGCA
    GCGTTTGCGATTGCTAACGGAATTGGAACTGCAGCGCCTGAATCTGCAGAGTACCATCCAGAAGCACCGTGGAATGCACC
    TGCAGACGCGTCGGATGGTCCGCCAAATGAGCGTTTGCCAGGGCGACGAGGAGATCTTCGATGGCGGATTGCCGGAGGGG
    CTGCAGAACGGCGAGGCCAACGATGATCCGGACGGAGTGCCTAGCACATCGAAGGCCAGCCGGTCGCGGATCGAGAATCC
    CAACCGCAAGCCCTTAAACCTGGAAAGCATATTGAAGATGGGCGAAAGCGAGGTGGACGAGGATGAGGATGTGGTCAAGT
    CGTCGCAGCTGAGCAAATTCAATATGCTGGCGGCCTCCATACGTCATCGTCGTCCATTCCGCAAGCGTCGCTCGTTCGAC
    GGCGGCGTTACCACGTCTGCAGCCGCGGATGCAGCCGCCGAACTGCAGCGGCGCTATCAACTCCGGGCCATGGATGATCT
    GCAGCTGGAGGGACGACTGGCAGGAGCGACGGAGGAGCGGTTCGGGGAGAGAAGTGGACTGGCCGACAGCGATGACGAGG
    AGGACGGTGAGGACATAGTGAACGGAGGACACCGGAATGCCTGCAACCGCAAGGTGGTCAAGAAACTAACCGCCCGCACC
    AAGGTATTCATCTCGTCGGTGCTGCGCTTCAAGAAGGCCATCAGCCTCAAGCGGCGCAACTCATCCAGCTGCAGTGATCT
    CTTCGTGATCTAAACGTTTGGCGGCGGCAGCATAGGAAGTAGGAAGCATAGACTGAATGTACATAAATGGAGTATAGATG
    GAGGCGAAGTAGGAGCATAGATATGGAAGCGAAAACGGAAACGCAACCGAAACCGGAACCGGAACCATCCAGACCAGTAG
    ATCCAGAGATCAAAACAAGCACAACGAAACAGCAGCGCAAACCGAAGTGGAGTCGAACACGGAAGTGCAGGAGTACAGGA
    GGGGTCAACTTATGAGGAAGTTTCCAGTTGCATATTCCATAAAAACTACAGGGACAATTTCTGTTTGATTGGCCAACGGA
    CGTTTGCAGATTCAGTGCTATAGTTTATGCACAGATTTTGATGGCAACTGCGACTCGTCGGGCGATGGCAAGCAATATGA
    AGTTCTGGGCCAACAAATTTCTAGAAACTTATAATCACTTGAAATGGCATTTAAAAGTGTGGTCTAGTTATCCGTGCCCG
    TGCGACTTGCGGACTGAAAATATATTGTAGACAAACTTTGGAAACATATGTAAGCGATATTAAGCATCTAGAAAGTTTTG
    AACAGGCTAATAGCATAACATTCAAAATAAAAAGCAAAAGACATACCCTTTTACCACGAACCCAACCGGTAGGTGGCGCT
    GCAAATGCGGACAATAATTTTCTTACAAAAAATATTGATCAGCAAATTTTACAAAATCGAAAATCCAAAATCGAAAAAAA
    AGGATTAAGCAAGTTATATGCAAATACAAATCGAATCGTATCCGCTTAAAAACAAAATGAAAAATGCAGCTAAAATG
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0301100
    8817
    FBtr0332388
    9704
    FBtr0332389
    8763
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0290321
    1418
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0290322
    1417
    FBpp0304662
    1417
    FBpp0304663
    1399
    Comments

    Transcript terminates at site supported by polyadenylated cDNA.

    UTR(s) based on RNA-Seq data.

    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (1)
    Reported As
    Symbol Synonym
    CG42541-RC
    Secondary FlyBase IDs
      References (0)