Open Close
General Information
Symbol
Dmel\fuss-RB
Species
D. melanogaster
Annotation Symbol
CG11093-RB
FlyBase ID
FBtr0301335
Feature type
Associated gene
Evidence Rank
Length (nt)
2638
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATATTCAGTTTTCGCACCTATTTCGTGTTGGAATAATCTAGTCCTCAAAGAAAGTAACTACTGTGTTAAATTTTTTAACT
          AAAATCGAGTATACTTTCTTTTATCAAACTATAAGATGTAACTTCAATAATGAGAAATATTACGTATATAAAATATACGT
          TCCAAATATATTATAAAAGTGGACCGAAATCTTAAAACAAACAAAAATAATACACACAATTTAAGAAACTTCACAAAAAA
          AACTGTGTTAATAAGGCGAAATGAATCTAAACGGAACTTGAACCTTTTTAAATGGATTTAAATGAAAATTTTAAAATGGC
          TTCTATATCTGTGGCTCACTTTGATAGGATGGAAAACTGCCAAACGTCTCAAAGGTCAAATCACGTAAGCTCCGTTTTGC
          TGTACGGAGTGCAGATTGTATCCCTGCACATTGAAGGTCAAGAGCGCCTTTGCTTGGCGCAAATTTCAAATACATTACTA
          AAACAATTCAGTTACAACGAGATACACAACAGGAGAGTTGCTCTTGGCATTACTTGTGTACAATGTACACCCGTGCAATT
          GGAAATATTGAGAAGAGCTGGCGCCATGCCAGTGAGTTCCCGACGATGTGGCATGATTACCCGCAGGGAAGCGGAGCGTC
          TATGCAAAAGTTTCTTGGGCGACAATACACCACCACGACTACCTGACGACTTTGCGTTTAACGTCCAGCACAAATGTGCT
          TGGGGCTGCCGCGGATCCTTTCTACCCTCGCGTTACAACTCATCAAGGGCTAAGTGCATTAAGTGTTCATATTGCGGAAT
          GTTTTTCTCGCCCAATAAATTTATTTTTCACTCACATCGCATAACAACTAATGACAGGTACGTTCAGCCTGATGCAGCGA
          ACTTTAATTCCTGGCGTCGACACATGTCTCTGAGTGGAAATGATTACGATGAGAAAATAATTCATGCATGGGAAGATGTC
          AAGGCCATGTTTAATGGCGGCACAAGAAAGCGGCTTGTTGGCAGCAGCATTAACCCTCGAAGTCCTGGCTCACCAACACA
          ATCCACTGCGGTAAGTTCCGGAGTTGGCAGCAGTTCCTGTGGCTCCCCAACGAGTTTCGAAAGAGATACCAATGAAGTCG
          ACGGGAAATCGGGGTCCTCGCTCCCACAACGCTCGCAGATCGACAGCCAGTACAACTACGGAACAGTAGCTGCAGCCGCT
          GCTGTAGTTGGAGTAACGGCGGTAGCAGCTGCAACAGTCGGTGTTCCCTTTAACTTACATGGCTCAACCGTCTTATCACC
          TTTGCATTCCCTTCGCAATGAACGTGATCTTTCTATAATGCCAATTTCCAGGAACTTTGTAGTGGACTACATGTGGCAGC
          AGAAGGACCAACATTATCAGCAGCCTTACGCAAGAAAAATCCCTAGCGGCGACAACAGCGACTCTAGCCTAGACTTCGAT
          TCCTGGGTTAAACCAGACTCAAACAATCCAATACCGAATGCGAATTCAGTTCGAACTTCGGATAATTGTTCTTTTAATAT
          TAAAAACGAGTCCCATTCCTCAATTTATGGCATTATAAAGAACCATAAGCTCTCTGGAGTGCCAAACAGCGGGCTTAACC
          TGTCCGATTATAACATTCCTTCCATTCTTAATTGCTCTGCGTTTAAACCAGTCGTCGCTTCGACAGCGATTGTGTCAACT
          TCCCTGTACACAAGATCCAATGAATCAACACGAACTGACTGTAACAACCCAGCACAATCTACAAGAACCACAACGGTTCT
          AACGCACAATAGTATTTCAGCCTCTTCCCACCAGATAGTGGGTCATAAGACTTTTTCGCCAATTTTAGGAAAAATTCATT
          CTAATCCGGAGAAGAATAGAATAGTATCTGTTTTCGCAAGTAGTTCGACTGGAAATGCAGATGATAATGATGATGACGAC
          GAAGTAGTAGACATCGAAACAACTGAAGATGAAGGGAAATTCACAGTTCAACACGCTGACAGCCCCAAAACACAATACGA
          CGCTATTAGCGGAAGCGACAGTCCCAGCCGTTCTCCGTCTACAAGTACAAATATAGATGTAGAGCAAGATGTCGATGTAG
          ATATTATTACAACAGACACTGAGGACCAACTAGAGTTAAGTGTCGGCCGGTACTCAACTGAGAACACAAGTCATTCCTTA
          TCATTTTTCCAAGCTGAGAAAATACAAATTTCAGATTTATCTCCCAATACAAAAACGTCGAGCGGCGATAATGAAACTAA
          CACTTTAAAGGACGCAAAAGGAATAAATGGAAATTTACAAATTTTAGCTCGACGAAAAAGAAACAAACTTCAAAAAGATC
          GATGTCTTTCCAAGCGAACGGTATCAAAATGTGTTAGTGACAAATCGCTTATAAAGGGCTTAGCTGCTAATGAATTATCA
          TCCAGCTTGCAAATTCAGCAGCATGTTGCCTTCCCTGTATTTTTAAAATCACAATTGCACTCTCTTCGTCCGCAACAAGC
          TCAGCAGGTGGTATCCCTGACCACCAACTCTGTGGCGGAGTCCAATAAGTGGAGTTATCCAGTCGGCAACATTGAACCAT
          TATGTTGTTATCAAACTTCTGGAAATAAAAATAGTCTAGTCTAGTTTTTGAAGAAATATAAAATCACTTACAAGTAAG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0301336
          2597
          FBtr0334625
          3094
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0290550
          770
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0290551
          764
          FBpp0306687
          770
          Comments

          GC splice donor site postulated.

          Transcript terminates at site supported by polyadenylated cDNA.

          Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (3)
          Reported As
          Symbol Synonym
          CG11093-RB
          CORL-RB
          fuss-RB
          Secondary FlyBase IDs
            References (0)