Open Close
General Information
Symbol
Dmel\E(bx)-RE
Species
D. melanogaster
Annotation Symbol
CG32346-RE
FlyBase ID
FBtr0301348
Feature type
Associated gene
Evidence Rank
Length (nt)
8975
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 89 )
Sequence
TAGCTATGTTCAAAACTGTAATGTTAGGTAAAAGTCTCTTTCGCAGTGTGCTGAAGATAGTTAAAAATATTAGAATATAT
CGTGTTAAATCCTGTGCAATTATTCCGCAACATGCTGGGTAATTTGCGCAGTTAATCCATGTGTTAATTGTGAAAGAAGA
GTGACATTTAAACAGACGCAAAAATTTTCACGGTTGCTTAAATGGCGGACAATGTGCGTTGGCTTCATTTCATCGCACTC
GCACACATACAATCGAACTTGGTGGTGCTGTCCAGTGCGTTTGCCGTCCAACACTAGAAGCCAAGAATGTGTTTTGAATA
CATGTACTTAATGTATTTAATCGGAACCGTTATTCTGAACTAAACAAGCTCTTTTGGCGGGTTTTTTTCAACTCCAAATT
TGCGCAATACAAAGAAAGTGAACACCCAACGACAAACTTTTGACGATCTGATCGATTTTTCCCCCACATACGCTGTTGAG
TAAATATCTAATGTGCAGCCTCGCAGCATTAACTTGGAACAATATCTGAGGAGAGTACCCCCACGCACCCCTGCACACAG
CCAGATAAATACGCAAGGCGAAAACAAACAAGATGAGCGGTCGCGGCAGCCGTAAACGTGGACGTCCGCCAAAGACGCCC
AACGAACGCGCATCAGGACGCTTCAATTACCAGCTTCTCAAGAAGCCGAAGTATCTCAGCGAGGGAAAGTCGCAGCCCAG
CACTCCGTCGGCATCCAGGGGCATTTCTCCACAGAGCGACGAGGGCAGCAGGAGCAGCCACAACAACCACACCAATCGCA
GTCGCGGGAGCGCCGCTAAGAGGGGACGAGGCCGCAAATCCGCCGTGCAACCGAACACCAGTAGCTACTCTGGAAGGAAA
GGGTACGAGTCGGAGTATCACTACGGGTCAGATTTTGGGGATTCCGAAGAAGATAAATCCGATAATGAGGATGATATGCT
GCTTACTCCCAGCGACGACGAGAGCCTAGAAGTAGCCAACGAGAGCGAATCAGAGTTTTCCGTGTGCAGCTTTAACCAAA
ATGGAGTTGGTCGGCCGCCACGTCCTCCTAGCCCAGAACCTGTGTGGCTGCAGGAAGGTCGTCAGTATGCAGCGCTTGAT
TTGCCGGACTCGTCGGAGGATCTTTTCATTGCTAATACACACGTTTTGCGCGCGCTAAGTATCTATGAAGTACTGCGACG
ATTTCGCCACATGGTCCGCCTTTCACCATTCCGATTTGAAGACTTGTGTGCAGCGCTGGCTTGTGAGGAGCAAAGTGCAT
TATTGACGGAGGTACACATAATGCTGCTTAAAGCGATTCTTCGAGAAGAGGACGCGCAGGGTACACATTTTGGCCCGCTG
GATCAAAAAGATACGGTTAATATAAGTCTTTACCTGATTGACTCTATAACGTGGCCGGAAGTTTTGCGAAGCTATGTAGA
AAGCGATAAGACATTTGATCGCAACGTGTTTCACATTTTAAGCCACACTGAATACCCTTACACGGGCATTGACAACCGGC
TTGAAGTGCTCCAGTTTCTGTCAGATCAATTTTTAACTTCCAATTCTATACGAGATGTAATGCTGCAGGAGGGACCTATT
CATTATGATGACCATTGCCGAGTGTGCCATCGGCTCGGTGATTTATTATGTTGCGAGACGTGCCCTGCTGTCTATCATTT
GGAATGTGTAGACCCGCCAATGAATGACGTACCTACTGAGGATTGGCAGTGCGGGCTTTGCCGCTCGCATAAGGTAAGTG
GCGTAGTGGACTGCGTGTTGCCACAAGAAAAACAAGGCGTGCTAATCCGGCATGATAGCCTCGGTGTTGATCGTCATGGG
CGCAAATATTGGTTTATTGCACGTCGCATTTTTATCGAGGATCAGGAGAACTTTACATGCTGGTATTACAGTACGACAAG
TAAGTTAAAATTGCTGCTCAGTCGACTGGACGCCGAAGAACTGGAAACTCGTCTGCATAGCCAGATTACAGAAAGGAGAG
ACGAAATCGAGCGCCAAATGAAACTGACTGAGACCTTAACCAATGAACACAAACACACGAAGCGTAGTGTTATCGAAATC
GAACAAGAGGCTAAAAATGAACTTTTGGAGAAAGAGGTGCTTGACGAGGATGAAAAAGATGGTGATGCTAAATCTGAGAG
TCAATCTATAGAGGGAACAAAAAAACAAGAAGAATGTAAAATGGTCACGCGTCAAAAATCCAATCAGCTGACTAATGGTA
CTTTGCATTTTAAACTTGGCATGGAGCAAGGATTTAAGAACTATGTCAACCAGTATTCAACAAATCCAATTGCACTCAAC
AAGCCGCAACGAAACGAGGAGCGAGATAAGCGACGCCATCTGTCCCATAAGTTCTCGTTAACGACGGCTTCTGACTTTAA
ATGGATCGGTATAACCATGGGAACTACTGACAATATGATAACAACTCTAAGGCAAACATTGATAAACTTCGAATCCAATA
TAGCAGCTTCCTTTTTAAATATTAACTGGGTAGTTAACAAAAAAATTTGGAATGCTGCGGTGATGAACGCCCGTCGACCT
TCTGAATTTGCGGTAGTATTGTTACTTTTTCAAGCGTCCCTTAAGAGCGTTGTTTTTGCCAACGTCTGGCATGAGCAACT
CGGACACACAACTTTGCAACGCATAACTAGTGCCGAACGAGAGGAGCGAAAAAAACTAGAAAAGCGAGAGAAGCGCGAGC
GGGATGATGAGGAAGAACGTAATCGCTTAGCATTTAACTACATAAAGTATACCCTGGGTCTCAAACATCAAGTCTGGAAG
CAAAAAGGAGAAGAATACCGGGTCCACGGGCAATGGGGCTGGCTTTGGCTCTCAAGCAGTCGACGCTGTGGTGTTCGTGC
ACGTCGAGCCCAACCTCTAACACACAATAGAGTCTACGTACATTACACCATGGGAGAGGAAAACGACGTAAATGAAATTA
TTTTAGTCGACCCACGCACCCAACGGTTTATGCAACAATGTGAGTCAAGCAATGTCGATGGTCAGGTGTGTCATTATTTA
CCGGACCAATATAAAAATGTGAAAGTTATAGAAGATGTTACGGAGAAAATCAAAGGGCACATCGACGTCAGCAAAGCGCT
AAATGCTCCAGGCCGTACTTATTATTCAAAAGTGGCTCGCAAATCTAGATTAGATGACTTATTGGATCGCCGTTTAAAGT
TGGCCGAGGTCGAGGAGCAGATGGCTTCTAAAATTCCTTCTGATATGAAGCCGCTTCTTGTTTCTTCCCAAAATAATACA
GCCAACAGCAAACAAACGTTTCTAGAGAAGCGTTTACTTCGCCTTACTGAAGTCCAAGCAAAGGGGGGTCCTGCAAACGT
AAACTTGGAACTTGTTAATTCGCTGGCTAAACAAATTCAAACCGTGCGCTTACAATTTAGTCAGCTTAATCGATTTGCTA
AAGTTTTTCGTTGTTATACAAAGGAGTGTAACACCAATTCAAATGCTGTCTCTCAAATAACCCAAAATACTTGCTACTCT
CCCTTATGTCTTCAAAAAGCTCGGGCCAAAAAAGAACTTCTTTTGTTGTTACGAAAGGCGCATACTGCCGGTAATGGCTC
AAAAGAGACAGTTGCCGCTATTTTGGGCGCTGTTAAAAAGCCATCTATTCTCGAGCAGAAGCTGACGGAGGGTAAAAGAG
AATCCACTCAGGTGGCCGTGGATGATTCTGAAGAGGGGAAGCCAGCTGAATCCGAAGCGCCGTTGGATTTACTTCAAGAT
TGGGAACATGCACGAGCGCACGCCGTTCCTTTTAGCGATTCTTTATTGACCGAATGCATCCTGGTTGACCAGGAGTGCGT
AACCAACACGAAAATTAAACAAGAGGTGAATGCCAGTTCCGGATGCAATACAACTCCTGACTCGAACACACAAGACTCCG
ATAAAATAGACTATATTGAGAGTATGGACGTTTGTAGTAATGTTGAAATTGAGAGTACCGAAGATTCCATTGTTACGGGC
TTAAACTCTGGTAACGCTGAAGATGTCGATATGACACCTGGATGGCGGCGAAAGCGTAACCAGAAATCGAAAAAAAGCTA
CATCGGCACTAAAGATGTGTTGGATCAGACGTTAGACAAGGATATACCACTTAACAAACAGAACCGCAGATTTCCTATTA
CTGCACGTCCGGTTAAGCGCGAATGTGTCAAAAAATACGAACGAGAGACATTTGAGAATGGAAACGAGCGGGTCTATTCG
ACTAGTTCACCTCGGGGTCGTGTATACCTCCTTAATGATGCGGCCAAGTTGTATGAGCAAGCTGTCAAAACTGAGGATAA
GTCAACGATAACTAAAAAGCCATCATACTCTCGGTATCCACTTATATCCAATTTTCTTACTCATAAAAAAAAGCGTAGCC
TTTTAGTGCTACCACGATTTGAGCTCCTGAAGCTGGCTCGTCTGGGTGGAAAATCATCGACAAATGGTTTTCATCACGCT
GCGAAAAATAACACAATTTGGCAGTATCAGTGCTCGCGTCCCCTCTTCCGAACCTGCTGGTCCTACAGAACATCTAATGC
CACGTCCTTATCCAGCCTAGCACTTCAGCTTCGAATATTGTGGTCGTGTCTCCGCTGGGATGACATGATAGCAAAGCCCC
CATCCACGGATGGGAAGCATCAGGTTACTACGGATACTGAAATTGTAACATTGGAATTGCTCAAACTTCGGCACTCAGGA
CGCTATGGTGAAAAAACAAGCTATTTGCGACGAAAAGTTGTTATTCCACTTGAAATGCCGAAGACTGTAAGAGAAGTAAC
ATCCATACGGTCCGGACTGCGAAAACGAAAGCGTGCTGAATCTCCTCAGCCAACCGAGCCACAAATTACCGAGGAATGGG
TCGACGAAGATAAATTGGAGTTATGGGAAATTAAATTTATGGGAGAAAAACAAGAAAAGGCACGCCTATCAGCTGTTACG
CGATCTGTAGCATCCCGTCAATTGGAGGCAAGTGGTAGTAATGGTTCCAACACTTCAACTAATGGAGCTCTTGGCGTCGC
CGGACGCGTCCAACTGGCACCCAAGTTGAGTGAAGATGTTAAAGAAAAAATGGAACAACAATTAAAATTACAGCGCGCTG
TTCATCAGCAGAGAAAATTGGTTGCAACTGGCGAAATAACCCGTTCTGTGACACCAGTTAAAGGCCAAGTTATCGGTAGC
AGGCGTGTCATTGTTAAAAACCCTGATGGCACAACTCGAATTATTCAGCAGGCAGTAACACAGGTTTCAAGAACAGGAGG
AGCTAATACTGCAGCAGCAGCTGCTTCACCTACTGTAGGAGGCTCGACAAGCACTCAATCAAATCCATCCACATCTACAC
CGCATAAAGTACAAATTATAAGGGGCCCAGATGGCAAAGTAAGCGTACGCGGGTTGAATCCTGGGCAGCAGCTGGTTCAA
ATGCCGGATGGAAAACTCCATGTGCTGACTACCACAACATCTTCAAATTCGGCGGGGCAAGGAAACAAAATGAAGGTTCC
CATTAAGCCAGCTTCTACTTCGTCGTCACCGGCAATCAGTTCAGCACAGACTACTACAAATCCAGTGACGCCAGTGATAA
AGCAAATTGCAGTTAAACATGTCACGAAAAATTCTGCGACCCAATCCATAGCATCATCCTCGCGCGTAGCCTTACCGCTT
GCTCAAATTAAGAATAAGTTGTTACTGGCCCAACAGCAGCAGCAATCAACATCTTCATCACCAGCAACTTCATCATCCCC
TGTGCAAAAGATAGTGTCGAAAGTGGTTAACACTAGTACCTCTGGGCAAACTCTACAGCAAGTATTCGTACAGTCTGGGT
CAAAACTGGTAGTGGGCCAAAATGCACAAGGGCAAAAGGTTATTATATCTACATCGGCGGCACAACAGCAAGGAACATCA
CCGGTTCAACAGCAGCAACTAGTACAATCGCAACCAATTCAGCAGTCACCACAACAGATCTCCATGACACAGGTCGGTAA
TCAACCAACGCAAAAAGTAATTCAGCAAATTGTTAATACCAGCAACGTGCAGCAGCAGATAGTAGTTGGCGGTCAACGGA
TTATCTTAAGCCCCGGTCAAACTATTGTTACTCAGAGGAATGTGCCGCAGAGTCAAGCATTGCAGATGGTTCAGCAGCAG
ATTCAAACCCAGCAGCAGCAGCAACAACATCATGTCGTCCAGCCTCAGCAACAATTCGTTGTTCAATCAAACCAAATTGT
ACAATCTTCGCCAAGTGCACAAACCAAACTGGTTAAACAGCTTGTGGTTCAACAACAATCGCAGCAAACCATTGAAGAAA
AAACGCAAATCACCACGACTGATAGCAATGAAACTGGCACACAACAAGTCTTGGTTCCAAATTCAACTTTAGCCCAGCAG
TTAGCACAGGGCAAATTGCAGGTGGCAACAGTGAATGGGCAACAAGTAATCGTAAAACCGTTGGGAAATAATCAGGCTCA
AATCGTGGCACATATTAAACACCAAGGTGATGGGAACGCTCACATCGTTACAAGTAATTCAGCTACTGCAGTACCTCAAG
CTAACCCGCAGACCTCACCAGTCAAGCAACAGGCTCTCCCACCACAAAGTCCACAACAAGTCGTTGTGCAGCAGCAGCAA
ATACATCAACAGTCACCCACAAACTTCGAAAGTGGCGTTACCCCAATAACTCAGCAGCCGGTTCTCACCCAGGCTGTCCA
GGCTCCAGCCCAACAGCAAGCCTTGAGTGTTGAGGAAAGTCTTCTGCAGAATCAGCCGCCTGGAACAGTAATTAAATGTG
TCACCGCTCAAGTATTGCAAACCGAGCATGGTCCACGTATAGTATTGCAAGGCCTGGTGGGCAACGATTTCACTGCACAA
CAACTGCAATTGGTGCAAACGCAGGTGAAGCAGCAACTAATGAAGGCTCAAGAGTCAAATGGCAAACTTGGTGTTCTAGG
CCCAACAAAAATATACTTGGCGGTACAGCCGGAAAATGCAGTTCAATCACAGCCACCTCCTCTAACCCCTGTTCACCAAT
CGGCTGCGCATCAGCAAACCAACAACATCGAAATCGACGCCGATACGCTAGCAACAACTTACGAAGCCAATTCAACTATT
AAAGATATTGCTATTAATAATGGCGATGATCAGGAAAACAGTAAATGTGCAGAAACAGAAAATTCTAATATTACAACTAA
TGAGTCCTTTGCCGGTACATCTTCCCTATTAGAGGGTTCAGAACATGATGAACCAACTAACCTTGCCGGCCTCGATATAT
CAGAAACAGACTTAGAAAATAAACAAAACGAAAGCTTCGTTGTTACCAGAGGATACATACAGAAGTCTATTTCAAATGCT
CTGAAACAAGGTAATTTAAGTCCGGAACTTGAAGAAAAACTTGTTTGTATGCAGAAGCAACAAGAAAATGCGAATTCGAC
GAATGAGTGGGAAACATGCTCAAGGGGCAGTGTGAATGAGGAAGCACTAACTCCCAGTCGCCAAACTGATGACACTGAAT
GGAAAATTCGTACTTCCTTAAGACGCCCAAATGCTATGACAACAAGCAGCCAATTTAATCGAATTTTAAAAAAAAATCGG
AGCAAGAATGACGAAGTCGCTGAACTTGGAGAGCAAAAGCAATCGCAATTGGAACGTCATAAAGAATTGCTTAAAAAAAA
TATTTTGCGCAAGCGTTCCTTATTAGAGCGTAATTTACAAAGCGAAATACACGAAGATGTAAAAACTAAAGTCCAAAGAC
ATGTACGCCCCTTAAGTAACGCTTCACCGGATGAACAAAGCGAAAATGAGAGAAGTGGCGAACCAAATTTAGATTTTAAA
CGGACAGAGGTGCAGAACCCCAGACATGGCGCAGGCCGACCAAAAAAGTTGACAAGAAAAAAGGAAAAGTTGTATTGCAT
TTGCCGTACTCCATATGATGACACAAAGTTTTACGTGGGGTGCGACTTGTGCAGCAATTGGTTCCATGGGGATTGTGTCA
GTATTACCGAGGAAGCTTCTAAAAAACTATCGGAGTTCATTTGCATTGATTGCAAGAGGGCGAGAGAAACGCAACAGCTT
TACTGTAGCTGTCGTCAACCATACGACGAGTCACAATTTTATATATGCTGTGATAAATGCCAGGATTGGTTTCATGGCCG
TTGCGTTGGAATACTTCAGAGCGAAGCAGAGTTTATTGATGAATATGTTTGCCCTGAATGCCAACGCAAAAACGATGCTA
ACGCTGCAAATATGAAGAAACTGACTTCAAATGACGTTGAAGAGCTGAAAAACTTAATTAAGCAGATGCAGTTACACAAA
AGTGCTTGGCCATTTATGGAACCGGTTGATCCGAAGGAAGCACCCGATTATTACAAAGTGATTAAAGAGCCAATGGATCT
CAAACGGATGGAAATTAAACTCGAATCAAACACCTATACCAAACTATCTGAGTTTATAGGCGATATGACAAAAATTTTTG
ACAACTGCCGTTACTATAACCCAAAAGAATCATCCTTTTATAAGTGTGCTGAAGCACTAGAGTCATACTTTGTGCAAAAA
ATTAAAAATTTTCGCGAAAATGTTTTTGACCAAAGAACATAAGAAATAATAGCCCTTGAAAACTTTAGAACAAATGATTA
TAGTTTATAAAGACACTTCTAACAATTTGAAAAACGTCCTTCAGTTATGTATTCTTATTTTGAATCAAATGTTATATAAA
CATATATTATCAATAAAAACACATATAATTAATTATAATAAATTATGTACATATTGACCATATTTAGTAACGTACACCAG
TATGCAATAAATTTCATATTCACCAGACATTTGTAAGATTAAAAATAATTAAGTAAAACCCCCTTTGTACAAAACATTAA
AGTGTAAATAAACAGCATGCATTTCATTTGATATCCTTATCATATGCTGTAGGTTTAAACTTAGGCGTATGTAACTTGTA
AAAATACAAGCTTAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0072521
9020
FBtr0072522
8960
FBtr0072523
7834
FBtr0301349
7362
FBtr0332101
8652
FBtr0332102
9296
FBtr0332103
8605
FBtr0332104
8517
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0290562
2669
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0072421
2669
FBpp0072422
2649
FBpp0089425
2159
FBpp0290563
2139
FBpp0304411
2163
FBpp0304412
2761
FBpp0304413
2668
FBpp0304414
2669
Comments

Extended 3' UTR based on RNA-Seq and/or EST data.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
E(bx)-RE
Secondary FlyBase IDs
    References (0)