Open Close
General Information
Symbol
Dmel\CLIP-190-RO
Species
D. melanogaster
Annotation Symbol
CG5020-RO
FlyBase ID
FBtr0301442
Feature type
Associated gene
Evidence Rank
Length (nt)
2664
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GGAGCTGTGCTACCATCGCTAACTCAGTGCAACAACAAAATTCCAACGCAACGCCAACTAAGTGCAAAAAAAATCTAAAA
        TTTGTGTAAAATTGTAAAATCCCAATCGCGTATATTTCTAAATCGTATTCGCACAGCACAGTATGTAAAGCACTCCAGTT
        TATTTAAGTACTGTGTGTGTGTGCGGTAAACACACACCAATAAGAGTGCGTTTTCGCGTCCCTTTTCCCACCCTCTTCTA
        ATGGTTCCCTCTTCTATAACTGTGTCAAATCAGCAGCAACAATAAAATATAGAACAGAGCTACAGCGTGCGTGTGTGTGT
        GTGTGAAATGCACAAATTGATAAGCAATTTGATTCAATTTAATCTTGTTTAAGTCTGATGAATATCAGCGCAAGCAGCCC
        AACACAAAATTATAAATAAAAAGTTACGAATTTATATAAATAGAATACCCTTGAGTGATTTTGTTAGTCGCATAAAATTA
        ATTCAATACATATTTGTGTTCCGCATTTTTTGAAAATATAACGAAGTTCTGGCCAACGAGAGCAACAACAAAAAGCGGTC
        TTGTTTGTTTTTCAAGCTCAACGAAAAAAAGAAGAAAAGAAATCTGCTCTCAGTCAGCTGTTTTAAAGCAGCCGCCTAAG
        TGCGAGTGAGATAGCTGCCTGCGCGCCAAAATAAAGCAACAACAAAAGTGGAACAGTGGTTCAAAACCTAGCTAAAAATA
        AAAAAAATCCATTTATTTTTGTAGCAAAAATATAAAATAAAAGCAAATTAAGCGAATTATACATATATTTGTTAAGTTTT
        TTAAATCGTTTACTTTTAATACGCGTGTGTCCTAATAAGTGAAGATTATTAAGAATAAAGTAAAAAATGAGTGATGATAC
        GAGCGCTTCGGGCGGGACAAGTGCCCCTTTTCCATCGCCAGTTACTGCGGACCCGGAACCAGGAGCCACTGCCTCCAAAT
        TACCGGGTCCCATCAGATCCAATATTCCCACGCCCGCTACTTCTGGTACCGGAATCCCGCAGCCCAGCAAAATGAAGGCA
        CCATCTAGTTTTGGATCGACGGGTTCTGTTTCCAAAATCGGAAGACCGTGCTGCAATCACACAACTCCCAAATCCGGTCC
        ACCACCAAGAGAAGCCACCAGCATGAGTCGTGAAAGCGATGACAATTTAAGTTCGATCAATTCGGCTTATACAGATAACA
        GCAGCGCCGTGCTGACAGCAAACACAGAGCAGTTCATCATTGGACAGCGGGTTTGGCTGGGTGGCACTCGTCCCGGACAG
        ATTGCCTTCATTGGAGACACACACTTTGCTGCTGGCGAATGGGCGGGTGTTGTCCTTGACGAGCCTAATGGTAAAAACGA
        TGGCTGTGTGTCGGGCAAAAGGTACTTCCAGTGCGAGCCGAAACGAGGCATTTTCTCACGCCTCACACGTCTTACCACAT
        ATCCCTTGGCCGGAGCCCAGACTCCGACCTCTCCATTGGCCAAAAGCTCCCCAGACAGATCGCGCACAGTTTCTCCAACT
        GCGAGTATTCGCAGCTCTATGCTTCGCAGTCCCGGCATTGGAGGCAAGAATGGAATGGCTGTGGGCGATCGTGTGATTGT
        CTCTTCTGGATTTGGTAGTCGTCCTGGTATCTTACGCTATTTGGGAGAGACACAGTTTGCTCCCGGCAACTGGTGCGGTG
        TGGAATTGGATGAGCCTAGCGGCAAAAACGATGGAACTGTCGATGATATCAGATACTTTGAGTGCAAGCCCAAGTACGGG
        GTGTTTGTACCTATTGCGAAGGTTTCACTGTCGCCGTCGTCCAAGAAAACGCGTCTTTCCAGGACCGGATCAAGGGAGTC
        GCTCACCTCGATTGGCACCATGAACAGCATCGCCACCACGGCCACGTCGCGCATGCGCATGAATGCTCAGCGCAAGTCGA
        GCACGCCCGTTAAGCCAATTTTAGCGACGCCGAAAAGCCAATTTTCCATGCAGGATCTGCTGCGCGAGAAGCAACAACAT
        GTGGAGAAGCTGATGGTGGAGCGCGACCTGGACCGCGAGGATGCCCAGAACCAGGCGCTGCAGCTGCAGAAGAACATCAA
        CGAGCAAATACTGATCGAAGCGGATCGCTGGAGACGCCTGATAGCGAGACACAGCATAAAGGTATCCGATCTGCGACGCG
        AGTTCCGCGGCTGGTCCGGAAAACACGAGAGTCACTGCATCCTGCACAGTGTCCTCACACCGCTGCGCATCAAGTAGAAA
        TCCGGATGAGAGGAATGGGCGACCATAGTGCTCAAAACTATTCGATTCGACGATTTTTGAATTACATTTCTTTGCACCGA
        GAAAGGAACCACTGAAGACAAAGTTGAAGTCTGCACAGCGTTTTAAGCTGATACAACCAAATAAAGAATTAAAGATCTTT
        AAAATAATGAAAAAAGGAAACCATAAAAAAAAACGAAAGCCAATCGAAAAACCAAAACGAATAAAGTTAACTTAAATGGT
        TTGATTGGCGTAAAAATATCAAAAACGAAATTAAAAAGATAAAAAAAACGGTTAATGGAAAAGTTGACTGACAATTTTCG
        ATTCTTTTGACGAAAGCGAATTTTTCTTGCTGTTGGTTTAGTTATTACGATATACACTTAAATACTATATATATGAAGAA
        AAATACACTAACAATATGCAAAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0080976
        5917
        FBtr0080975
        5625
        FBtr0080977
        5453
        FBtr0290262
        1723
        FBtr0290263
        1615
        FBtr0301440
        5851
        FBtr0301441
        5291
        FBtr0332451
        5349
        FBtr0332452
        1900
        FBtr0332453
        5283
        FBtr0332454
        5806
        FBtr0332455
        1549
        FBtr0339796
        1357
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0290657
        456
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0080529
        1690
        FBpp0080528
        1689
        FBpp0080530
        1652
        FBpp0288701
        365
        FBpp0288702
        328
        FBpp0290655
        1668
        FBpp0290656
        1598
        FBpp0304724
        1623
        FBpp0304725
        311
        FBpp0304726
        1601
        FBpp0304727
        1653
        FBpp0304728
        306
        FBpp0308841
        327
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CLIP-190-RO
        Secondary FlyBase IDs
          References (0)