Open Close
General Information
Symbol
Dmel\Mondo-RF
Species
D. melanogaster
Annotation Symbol
CG18362-RF
FlyBase ID
FBtr0301457
Feature type
Associated gene
Evidence Rank
Length (nt)
4834
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 66 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AAATGCTTGACAACCCTGATGGGATGGTGAGGGCTCGCTACCCGCAATAGGTTAATGTGTGCTATATTGTGATTAAACTA
      CGTAGAAGCTTTGTGTTGCGCGTGTGTGCGTGGTATTGGTAGTCCGTCGTGCCTGCTAACTGCCCGTGTTTCTGCTATAG
      GGGGCAGTTGCAGTTGTACCGAAATTGTGGTGCGCGTGCATGCGCGTGTATATGAGTGGGAACGGAAAAAGGCAAAATGC
      AAAGGCAGCGCTGAGCCAGAGGTCAAAAGTGCAAACACAGAACTGCTTGTGGAGTGCATACTCTGGATGGCAAGGCCGAA
      TGCCAGGAGTCAAATCGACTGAGCTCCATATAGTAATAGTGGAGAGGGGGACAACATTGCTGCCTGACATCTGCGCATAT
      AGAAGAACACGTACATACATACATATACATATGTATGTACGTTTTCCTAGCTGATAAGCAACGCTAGCGAGGTAGGGAGA
      GAGAGAGATTTCGCGTCAGCTGTTCATTGTTGTGTTGTGTGCGGCGCACAGGTTATGTGCGTTTCGCAGCTTCGTTCTCC
      GATCAGTTCTGTTTGTGGAATGAAACCGATCGTTCTGCGCTGGTTCTGCCCGCCTTGTTGGCCTTCCATCAGATCCGCGT
      GTGTTTACGAGTAGTTGGGGCTTCACTATCTGTTCAAGGAGCTACAAGCGGCCACTGACGTCTCGTTCTGACGTCCGTAT
      CCCCAGCCAACCCCGCCGCGATTGTGTGTGTGTGTGTGTGTGCGAAAATTGTTGTTATTGTGCTGTGTGACGCATATAAC
      GGCAAAAGCGGGGCGTGTTTGCCATTAGAGAAGCTTCGCTCCGGAAAAAGCAACAATTGGACAGGTGTCGATGACGAAAA
      GCTGAAGGTGTCGGGCATTGTAAACAAATCAAAATCTTAAAACCGTGCTATGTCTCTATCAAATAATCGCTTATTTTAGT
      AATTTAGTTAATAGAATGACAAGGACAAACACTAGATGAGAGAATTAATAAATGTGTTAACCACGAGGCAAGACAAAACA
      TATTTTTTTTTATAGTCTGCGAACGTTTACATATTTTGAAATGATGGAAAAACCCCATCCAAATTAAAAAAGGGTCAGCA
      CCAGCTTTTAAAAGCCTTTACTACGCGAGAGACATTAAAAAACCATTAAATGTGCCCTCGCCATATCGACATAATCTGCA
      ACCGCCAAAATTTTGGCTCAACAGTAAACTATTTGCATAGGCATCCCCTGGCACCTGTTGAAAATGATGCTGAATAAACA
      CGAGGGATACCAACGCACAAGCCAAATGTTTCCCCACCAGCAGCACCAGCTGCCTCAGCTGCACCAGCAGCCTTATCTGC
      AACAGTCTCTGTGCCAAAACTTCCAGCAATTGCAGTACGAAACGGGAGTAGGTGCTTCGGCGTCAGGGTCCGCCGAGGCT
      ACGGCAGACCTGCTCAAGGCGGAGCGGGAGTCTATCCACTCCGGCCAGTTTATGGTCTCGCACTTCGAGGCAGAGGAGGC
      GCAGGACGACCTAGAGGATGACGGCGAGGTGAAGATGCTAGACCCTGAGGACCCCGGTCTGGGCAAGCCGGGCGAGCCAA
      CCAACACATGTCGTGACGTGCAGCTTTACGTACCCCAAACAGTGGCCCACTTCAGCGCCATGGACCAGGAGGGCGACGAG
      AGCAGCATGAGCATGGTGACCTCCCACCTGGAGATAGAGACCTCGCTCACCAAACTCTTCAAGTGCATGAATCTGGCCTA
      CAGTCAAAAACTAACCTCACCCAAATGGAATCATTTCAAAGGAGTACGACTTCGGTGGAAGGACAAAATTCGCCTGAACA
      ATGTCATCTGGCGTTGCTGGCACATGCAGTTCATACAAAAGCGCAGAACCCCGGTGTGTCAATTTGCGTCGCCGCTGGAC
      GTTGATATACATAGTAATCCTCAAACTGTTGTTCTTGAAGGCAAATACTGGAAACGGCACTCAGCTGTTATAAAAGCCGA
      ATACAGGAAATGGCGCAGGAACTATAGGTCGAAGGCTACGGGCTGCTTAACATATGATTCGAAAAGCGAATTAGACTTTT
      TGGAATGGTCGCCTCTGAACGATAGGAACTTAATGCCAGACGATTGGACCACAGACACCTTATTCTCGGCTATAAACGTT
      CCATTCCCATTTCCAGATTCTAGGGAAATCGCACGCGGCGCGGGCATCGCGGACTTTATACAGCCCAGTCTTGGTCCCTT
      GCAACCGAATTTAGATGACATCGACATTAGCTTTTCAGACTTGATTCCAACCACACGCTTGCCTCCAGTTCCAGAAGAGG
      GAACCGACGCTGAAATGCTCAAAAACGACGAATATTGCCTGTCAGCGATTGTCGGTGCTCCTCATACGCTGTATTGCAAC
      GATAGCATAATGGATGTGGTAAACAGCAGTAACAATGGCGCTGTAAATGTAGATGCTAGCATGCTTGAGCTTAACACGCC
      CATAAATAACGTATCGTACGGTGAGGTAGAGCAACGATTTTCTGTTGCACGGCAGGTGCAGCAATCCAACAATGATTCTC
      AGCTTCTCGGAGACTCGGGTTCAATGTCCGGACGAATACACGGAGGCAAGCATTTTGGACCTGCTAGCGCAAACGACAAC
      AACACCAATAGGTGTGTTATAAACGGTCGCGTGGCCAAGAGCACTCAGCGGCCATTCCGACGCGAGCCCCACAATTATGA
      CAAGGCCCAGCCCACAATGCACCAGACGAACCTGTATCAGCAAATGTTGGCCGAACAACAGAAGAACCAGCAGCAGCAAC
      ACGTGGTAGTGTCTTCATTTCAGGCTTCCCAACAACAGCAGCTCGCTCAACAGCAACCCTTTTCGGCCCAGGCAACAAAC
      GCCTTCAATAATCAGAGTTTTATTAGCAGTTACGCAGATAACTATCAGCATCAGCAGCAACTCAACGTCAAGGTAGAACC
      TCTACATGCCGATGTGCTGTCATTACTAAACGACAATGCATACAACTCTATTGGCTACAAGCCCTATCCGCAATTTAAGA
      AGTCCGCCTCGACGGGAACTTTTCTTAATGTCCCCAGGCAGACGCAGCAGCAGCAAAGTTATCTGCAGCAAGAGCCCCCG
      CAAATGCAACAGTCCCTTCCCGTAGGCATGGGAAATCAACAAATTTTGCAGCTTACGCGTCAGCAGCAGGTTAACAATAC
      ACAGCAACAGCAGCACCAATCCACAGTGGCTAGCTTGTTGCAGCAGCAGCACCAGCAGCAAAACCATCAGCAACAGCAAC
      TACAGACTGCTGTCAGCTCAGCCACATGGGTTTCGCCAAACACCATTTTGCCTAAAGAAATCTACCGCTCCAACAGCTTA
      CCACTGAATGTTTCCCTTAATAAACTACCCGATGGTCGCCAGCTGCATCATGAGCAGCCCTTCGCAGTGCCCAAGTATCA
      CTCCAAAAGCAAGTCGAGGGTGCGGAGTAATTCGATGCACCAGCAACACACTTCAGTGGTGTCTGCTGCTGGAGCGGGAA
      GTTCTTCATTAGGCGCACATAGTTGCAGCAACCTGCTGGTCACTCAGCAAATGCAGCAGGCAACCAGCGATCCCATGCTA
      AACAGCACCCTGGCTCAACTGCTCACTTCGAATTCACGCCTACAAACAGCAGTGGCGAACAGTTCGTCATCAAATTCACC
      TTCCGTCAGTGCCATAGCCACCACTAACAGCAACAGCAATGCGCCTCCGGTTCATTACGCTAACGTCACATCGCCGTTGT
      CGGTTCCGGTGCCAACACATCAACACTCACCAAAAAAGTCCGCCTCCTTGCCTATGGCTGTCAACTCTGCATTGCACAGT
      CCCCCTCTAGGAAGTAAAATACACGGTATTGGGCTGGCCACAGCTAACGTGGGCAGTAATAGCTTGAGTTTGTCACCGGA
      ATCGACGTTCCACGAGTCACAGGATTCCCCACTGTCTCCTACAACCAGCCTAAAATTCCAGCCGCGAGACACGCAGCGTC
      GTGCTGGCCATATCCACGCCGAGCAGAAGCGGCGTTACAACATAAAGAACGGATTTGACACTCTGCACGCGCTCATACCA
      CAGCTTCAGCTAAATCCCAACGCCAAGTTAAGTAAGGCAGCCATGCTACAAAAGGGAGCGGACCACATAAAGCAACTGCG
      ACAGGAGCGCAATGTTTTAAAGGATAAAATTGAAGCTTTGCGCATGGAGCGAGACGAGCTAAACAATTCGCTGACGCACC
      TTCACTCAATTTTGCCAGCTAATGGAGCGCCTGTAACGAGGCAGGGTACAGAACATGTTCGGCAGCTTTACGACATTTAT
      GTACGATACAATACAATGAACGACTGGAAATTTTGGATTTTGGGTCTCATTCTGGAACCTTTGCTTGCCTCTTACACGTC
      AACAGTCTCGAGTGCTAGTCTTGATGAGCTACGTCGGACCGCTTTTCTTTGGGTTGATCAGCACTGTTCCCTTATTGATC
      TTCGTCCAGCTGTTACAAATAAATTAAAGTATCTATCTATGCATACGGATATTGTTTCGGAGCCACCAAGTACATTGCAA
      GAGGAGGTGGCCAAAGCCCTCCAGAATTCAAGTGGCCAGCATCCAAATCTGCATGGACCCTAACCGTTGATGCTGATGTC
      CTTGATATGAATTTATTTAATTCAATCTTTATTTTAACAAATAATTTTTGCTAACTGCTCAGCACTAATTGTACAAAATG
      CCTGATGAGCATATTTTTATACAAGAAATGGGCAACCGGCAACCAATAAATACGCAAAGCAGCAATTAGTGCCTAGATTC
      TTGACTTAAGCGTATAATAAACTAACGATTTTAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0081525
      3837
      FBtr0081524
      4276
      FBtr0081527
      3300
      FBtr0301458
      3928
      FBtr0301459
      4837
      FBtr0301460
      4349
      FBtr0301461
      4276
      FBtr0301462
      3830
      FBtr0301463
      3832
      FBtr0301464
      4068
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0290672
      1119
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0081053
      1119
      FBpp0081052
      1119
      FBpp0081055
      925
      FBpp0290673
      1119
      FBpp0290674
      1119
      FBpp0290675
      1119
      FBpp0290676
      1119
      FBpp0290677
      1119
      FBpp0290678
      1119
      FBpp0290679
      1119
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      Mio-RF
      Mondo-RF
      Secondary FlyBase IDs
        References (0)