Open Close
General Information
Symbol
Dmel\siz-RD
Species
D. melanogaster
Annotation Symbol
CG32434-RD
FlyBase ID
FBtr0301602
Feature type
Associated gene
Evidence Rank
Length (nt)
4931
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 42 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATCAACCGCCACGCCCCCCGCCCCTCGCGTACGTGTATGTATTCGACTGTCTGCCGCCTCAGCCGCAGTCGACGTCGCTG
      CCACCGCTTAAATATCCCCAAAAACGTCCCTTGAATTCATATACATATATATTTTTTATATATCCATCTACACTCAACGG
      CGATTAAAAATATATCGCGAAAAGAAAAAATATAAAAACGAACTTCAAAGTGAAATTCGAAATTCCTCACCCTCGACGTA
      TTGATTTTTCGTCATCTTCATATTTATCGGTGCCAAAGTGTTTGTATACCGTCCAAAAACAAAACACACTCACACACAAG
      AACCTAGTTCCAACCGCAAAATAATAAGAAAACGATTCCGTTTCACTGAACATTCTGCCTTAAATTTATTTAACTAATAC
      ATCACTGAAGCGAATCAACTAACTAGGGACTTAGTTAGTGGGACCAGCTTTAGTCCCCCCAATTCGCCACCCCCAGAAAA
      CAACAAAAACACACGGCAGAATGAGCAGCTACACTGCCGCCCAGTATTACAAGACCACCAATATGATTACCTCCAACGAG
      ATTTACTGCTTTCCCCAGAAGAGCCTGGAGCGAAGTGGTTCCACCCAGTATGAGCTGGCTGGAGCGCAACAGCCAGGATC
      AGCCAACGCCTCCACCTGCACAGATAGCGGCAGTGTTGGCGGCTATGTTTACCTGCAGAATCACTACGCCCCCGGCGCCC
      ACAGCTCCTCAGCCGCCATCAACTACCCTGCGCAACAGCATCCCCAGATGGTCTACCAAATACAGCAGTATCCCACGTGC
      CATCAGCAGCAGCAACAGCAGCACCTCCAGCAGCAGCAGCATTTGCATCAGACCGGCGCAGGTCACTACATGCAGGTGAC
      GGCGACGGGTGGTGGCCAGTATCATCACCATCACATGCTCCATGGTCACGGGCATCATGCCCACCATCACGGTGGGGCGG
      TGGTCATCGCCGGGAGTGGTGTGGGAACTGGCCTGGGATCTGGAGCCACCAGCGTGATCATGCAGCACCAGCAACAGCAG
      CAACAGCAACAGAATATGCACAAGAAGAACTCCATCCGGAACGGCGGAGATGTCCTCAAGCGAACGCGAGCTCAGTCGGC
      CTACGAACTCTCACAAGATCTGCTTGAGAAACAGATCGAGCTGCTGGAGCGCAAGTACGGCGGAGTGCGAGCCCGTAACG
      CAGCGGTCACTATTCAGCGCGCCTTCCGTCACTACATGATGGTCAAGAAGTTCGCCTCGATCACGGCAATGGCCAAAGCT
      GAGAAGCGTCTAAGCCGGCGGATGGTGGTTACAGCCAGCAGTCTTGGATTGGCGGAGGAGGGTGCCTCCTCCTCGTCAGC
      CTACGGAAGTGCCACGGAATCTCAGCTCACCGAGCAGCAACAGCAACAACAGGCGCAGCAGCAACAGCAGCCACGTGTCA
      CCATCATGGCGGGTCCGGCGGGAGCAGCTTCTCCGGGCTTATCCCGGACGCCACCTACGCGATCGCTTTCCATGCGGGAG
      CGACGTCAGCTGGACTGCAGTCCCATACCGCGTAGTCAGTCAGGAGCCTCTCCCGCCTCCATATCGAGCTCGACAGTCAG
      CACATCGGCTCTGGCCTCACATCCACATGTTAATCTGCTGCACGCGGCAGAGCCACATTATTATAATGCTCAGGCACTGC
      CCCAGGGAGCTGCTTACTACACTAGTTACCATGGATCACCGCACGACTTGAGCTATGCCAGTTCGGCGGACACCTCGCTA
      AATGCCTCGTGGGTTAACACGAGCGGCCACTCCCCGCACACGCCCTACTATTCGGCGGCCCAGATCTATATGCGACCCAA
      GGGCGGCAGCACCACGCCCACGCCCAGTTGCAGTGGCAGCACAGGTAGCGGCAGCGGAGGCAGCGGGAGTGGCAGTAGCA
      AGAAGGTGCCACCAGAGGTGCCCAAACGCACCAGTTCCATTACGGCACAACAGCAGACACAGCTTCTTTTGCTGCAGCGC
      CAGACACCGCCGCCTCCTTCGCTGCTAAGGACCAATGGCCTGTGCAAAACCGCCGAGAACGGCAGTCTGACCTCCGTGCA
      GAGTTCCGGATCGGATTCTAGTGTTACCTCTGCGGAACGCAATCTAAACAGCGATTTGGGCTCGGATCGCAGTAACTCAC
      CACATACATGGAAACGAGGAACAGCCCTAAATAGTTCCCAGCAGTTCTCCACGCACTCGGCGGATTCAGCGGGTGCGGTG
      TCTGGTGGAGGAGTTGGAGTGGCTGGAGGAGCCGGCGTTTATGCCGCTCAAATGCAGGCTGCCGTTGCAGCAGCTACAGC
      GGCAGGAGGAATGCCACCAGCGGATGACCATGCTATCTCCTCGCATACGAGTGCCGCTCAGTATGAGCAGCATGAGCAGC
      AGCAGCACGAGCAACAGCAATTGCAGGCGGCAGCTGCAGCTGCCGGAGTGGCACAAAACTACAAGATGTCGGAGACGATA
      CGCAAGCGACAGTATCGCGTTGGACTCAATCTGTTCAACAAGAAGCCGGAGAAGGGCATCACCTATCTGATCAGGCGGGG
      ATTCCTTGAGAATACACCACAGGGCGTTGCTCGTTTCCTCATCACCCGTAAGGGTTTGTCCCGGCAAATGATTGGCGAGT
      ATCTGGGAAATTTGCAGAACCAGTTCAACATGGCCGTGCTCAGTTGCTTTGCCATGGAGCTGGACCTGTCCGGCCGGCAA
      GTGGATGTGGCTTTGCGAAAGTTCCAGGCCTATTTCCGCATGCCTGGAGAGGCACAAAAGATTGAGCGCCTCATGGAGAT
      CTTTTCACAGCGCTATTGTGAATGCAATGCGGACATTGTCGGGCGATTGAGATCATCCGATACGATCTTCGTCCTGGCTT
      TCGCCATCATCATGCTGAACACGGATCTGCACACACCCAATCTAAAGCCAGAACGTCGCATGCGCGTCGAGGACTTTATC
      AAGAATCTGCGCGGCATCGACGACTGTCACGACATTGATAAGGACATGCTGATGGGCATCTATGACCGTGTCAAGTCCGA
      CGAATTTAAGCCCGGCAGCGACCATGTCACTCAAGTGATGAAGGTACAGGCCACTATTGTGGGCAAGAAACCAAATCTAG
      CGCTGCCCCATCGGCGTCTTGTCTGCTATTGCCGACTGTACGAGATTCCTGACGTGAACAAGAAGGAGCGACCTGGTGTG
      CATCAGCGCGAGGTGTTTCTGTTCAACGATCTGCTGGTCATTACCAAAATATTTAGCAAAAAGAAGACCTCCGTGACGTA
      CACATTCCGCAACAGTTTCCCGCTATGCGGCACCGTTGTCACCCTTCTGGACATGCCCAACTATCCGTTTTGCATTCAGC
      TCTCCCAGAAAGTGGATGGCAAGATCTTGATCACCTTCAACGCCCGCAACGAACACGATCGCTGCAAGTTTGCCGAGGAT
      CTTAAAGAGTCCATTAGCGAGATGGACGAGATGGAGTCGCTGCGCATTGAGGCCGAACTGGAGCGCCAGAAGTCGGCGCG
      CAATCGAGCACCTGGCAATGCGGAGAATCGTGACAGTGGCGTAGCCGATGTGGAGGTCTGCCCATGCCCGTATCAGCAAG
      GATCACAAGCATCTGGCGAGCAGGCTCCAAACTCTGCCGATAACTCGCAGCAGCTGAAGCGCAGTGCGCTGAGCAACAGC
      CTTCTCGACATGCACGAGCAGTTTGGCAATGAGAAACCTCAACGTCGTGGCAGCGTTGGCTCCCTGGACAGCGGCATGAG
      CATCTCGTTCCAGTCCACTACAACATCCAGCGCTTCGAGGGAAAATGCCGCTGCCATTGCGGCCGCAGCAAATGCAGCTG
      CAGCAGCCAAGATGCGATTTAACATGCCGCCAACGGCAGCGATTGCCACGCCCAGCAATGTGTATGCAGCTCCGGGAATG
      CAGGCGTATACCCATGCCAACTTTGTGCAGCAGTCACAGGCCGCCTACATGTTGCAGCAACAGCAAATGCTCCAGCAGCA
      GGCACAAATGCAAGCTCAGGCTCAGGCTCAAGCCCAAGCTCAGGCCCAAGCTCAAGCCCAGGCTCAGGCGCAGGCGCAGG
      CGCAGCCGCTTACTGGCCGAATACCGGGACGCGAGCGAAAGGCTTCGCGGACGGATGAGAACGGACGGTCGACGGAGGTC
      TAAGTCATCTATTGTACATTTTAGTTATTGAGCAAAGCGATAATTATAATATCTATATAGCATATTGAATGAAATATCTG
      TATAATCCGAATCGAAACGACCCGAACGCCATTTTCTTCAACACCTAACCCACACACAGCGTACGAGTATATAGTGAATT
      CTTAATGTTCCTTCGTTCTCTGCTAATATTAATGTAAATAAATTAAACATTTGTCTGTTTTACACTATCTACACACTAAA
      ATAAGTTTCTAAAACTATTTGTATATACATCAGCATACTATAATACACCCACAATCTATGAAAATTATTCTCTAAATATG
      CATATGTATTATTGTATAACTCTAATCCTCTCCAGACACTTGAAACACCAATTTACCCCTGGGCAACCTTCTATGCCCAT
      ACCCGTTTTGATCTACCCCTCCCCTTACGAATTACAAAAGCGATTGGCGAAAGTAGTTTCATTAGCATATACTAAAAACT
      ATATCCCGATAAGTGCGCGCTATGTATATTATATATTTTGTTTACCCTACATTTTCTCTGTGTAACTAAAAAGTGAAGTT
      CGTGTATACCGCGTGTGTGTGTATATACCCTGAATATTAATTTAAAAGCATTTAGCTATAATTATTCATATTTATAGAGC
      CAAAACTACCCAAAACCTAAAATATTAAATACGAGTATAACAAACACGAAGTATATGAAAACAAAACAATATGTATATGA
      AAAAGCAAAAGACTTAAAAATTTCAATAAATGAAAAGAAATAATACCAATG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0078290
      5314
      FBtr0078289
      5130
      FBtr0111038
      4654
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0290817
      1220
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0077948
      1313
      FBpp0077947
      1325
      FBpp0110337
      1210
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      siz-RD
      Secondary FlyBase IDs
        References (0)