Open Close
General Information
Symbol
Dmel\7B2-RB
Species
D. melanogaster
Annotation Symbol
CG1168-RB
FlyBase ID
FBtr0301640
Feature type
Associated gene
Evidence Rank
Length (nt)
1148
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 95 )
Sequence
GTATATTTCGCAAATTCAACTGGTAGCCGCCGCACGAAGCACAGAGCCCTACGTCACGTTAGTATATACACGGAATCGGA
GCAGCTGCCGCCGAAAAATCAATACCTTACCAAACTTCGACGTGGACGGTTGAAACCGCTTGGAATCGCAATATGTTGTT
CCGTTCGCAAACCCATGTTTTTCCAGGTGTGTACATGATGGTGGCGATGCTCGTGGTCGCCTTGAGTGGCTACCAGGTGC
AGTCCTATAGCGCCAAGGATATTCTTGCCGATGTCTTGATGACGGATCTGCTGAATCGCATGGACAAAGACATGCAGGTG
GGCTATTACGACGTGGGCAACGAGGCAGCCGCTGGCTCCAAGGACAACGTGGACCTGGTCTCCCGGTCGGAGTACGCGAG
GCTGTGTGACGGCGGAAGCGACTGCATCCTGCAATCGGGCTCGGCATCGGGAGCTGCCTCCCATCCTTCGCTGCGGGATG
ACGAGTTTCTGCAGCACAGTTCGCTGTGGGGTCACCAGTTCATCTCCGGCGGAATGGGAGAGGGTCCCAACAGGTATCCC
ACTATAGTGAAGAACGACGCCGGCCTGCCTGCCTACTGCAACCCTCCTAATCCCTGCCCTGAGGGCTACGACATGGAGAC
GCAAGGCGGCAGCTGCATTGTCGACTTCGAAAACACGGCCATCTTCAGCCGGGAGTTCCAGGCCGCTCAGGACTGTACCT
GCGACAACGAGCATATGTTCGACTGCTCGGAACAGGATAGTGCTGATGTGGGCGGCGACAAGGGTGACCTGAACTCCGCC
GTGGAGCAGTACATCATGCAGATGGGCCAGGAGAACAGCCTGAACAACGTTAACAGCCTGGCTAAGAAGGCCGGATATCC
TGTGATGCCCGATCCTCGGCTGGACGACGCGGTCATAAACCCGTTCCTCCAGGGCGACCGCTTGCCCATAGCCGCCAAGA
AGGGCAACCTTTTATTCCACTAAGGTAACTCGCTGATAACGCGAGCATACACGACGTTTCCATATGGGTGTCTAATACTA
TTATCTATCATAGCTGGTTATCAATGTTGTCCCGCAAGCGATGTCTAGTAATGTTTCTACCCTTTCCCGAAAATAAAGTT
ATTCGTATAGTACCAGGGCTCTAAGCCG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0078789
1133
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0100150
276
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0078435
271
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Secondary FlyBase IDs
  • FBtr0100112
References (2)