Open Close
General Information
Symbol
Dmel\Fer2-RB
Species
D. melanogaster
Annotation Symbol
CG5952-RB
FlyBase ID
FBtr0301709
Feature type
Associated gene
Evidence Rank
Length (nt)
1336
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 5 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AGTGCGTAAAAGTGTCGGAAAAGTTAATAGTCGTTCTAGATTTTAATTGGATTAATATTGTTTAGTGAAAAAATAACACA
      TTTGATAAGAAAATGTCGCGAAATCAATTGCCGGATTCGTCGTCTTCACCGCCCATTAGCCATTTACCCTTCCACAATTT
      CGACGATGATCTGATTAACGATTTGCCCTCCTGCATTTATGCGGGTCAGCATCAAGGCGGAGGCGCCACCGGTGGAGGTG
      GTGGATCGGGAGGTGGCGGTGGCAGTTCTGGGCTGCGTCTGAGCTCCAACAACCTGCGTCACATCCAGCAGCATTATATG
      CAACATAGCGGAGAAAATCTGCTCGACTCCTCTACCAATCCAATGGGGGTGCACAATTCCGGGGGAGGAGCACCCTTAAT
      GTGCAACAGCCCCAGTGCCAGCAGCAGTGGAGGAGGGTGCGGCAACGCAGGATCTGCTACTCCTGGCGGTGCAGGTGGTC
      CCAATCCTGGATATGGATCCGTGGGAGCTGCAACTGCGTCCAGCTACAAAATGCAGCGACAGGCGGCCAATGTGCGGGAA
      AGGAAACGCATCCAGAGTAGCATCAATTCGGCTTTCGATGAGCTAAGGGTCCATGTACCCACCTTTCCGTACGAGAAACG
      TCTGAGCAAGATCGACACTCTGCGGCTTGCCATCGCCTATATATCTCTGCTCCGTGAGGTACTACAAACCGACTACGATC
      CCCTAACCTATGTGGAGAAGTGTCTGCGCGGAGAGATCAAAGCGGATAGGGCTAATTGGAATACGAGTGATCTCACAGCT
      CGTCTGTCGTGGATCAACTGGGAGAACCTCGGAGTACATCCTGGTAGGCGAACCCTGCTTACCTCGTTGGCTCTCTCCTC
      GGAACCCATGTGCGGAGCTCATTGCGGAATGCCGTAGATTCGCTCTATATATTTGAGGCTTAGCCTATCAACTGCTGAAA
      GCACTTACCACTTAAGCTTCTGATCTTCCCCAAAGATTACAAAGTCTTCCCTTTAGGTTTTGATATCCCAAAATAGTTTA
      AGGCTGGACATATTTCTACAGTTACTAACAGTTAGCAATAGTATTTTATTTGAAAAGCGTCTCGGCTGCACGAAATACAA
      GACCCATCTGCCATTGAAGCCCACTACTGTGTTTAATAAATAGTTATTGGTTTCAAAGGCTCGCAGGATAATGCATTTAC
      AAATCAATTCCTCAAATTATATTTCAGGATAAATCTTTTGTAAATAGTATTGAGTATTGGGCAACCGATCTGACAAACCG
      ACAAACCAGTTGCAGCTAACAGACGTTTTACAGTTAGTCAACTATGTAACAACTTT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0344010
      1351
      FBtr0344011
      1363
      FBtr0344012
      1333
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0290923
      274
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0310461
      279
      FBpp0310462
      283
      FBpp0310463
      273
      Comments

      UTR(s) based on RNA-Seq data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Fer2-RB
      Secondary FlyBase IDs
        References (0)