Open Close
General Information
Symbol
Dmel\Hel89B-RB
Species
D. melanogaster
Annotation Symbol
CG4261-RB
FlyBase ID
FBtr0301715
Feature type
Associated gene
Evidence Rank
Length (nt)
6481
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GAAAACTTAAAAATATTGTGCTGTCAGAGTGTGTTTGCATCAGCGTGAAGCCCAGTGTTAAGTTAAAACATTGACTGCCT
      ACGCCCACCAACGACAATTGCCGTAAATCGAATTCTGCCGTTATTCGCAACGCCGGATTCCCATCCGTGTGTCCGTCGCG
      AGTGTGCCAGTGTGCGTGAAAATAAAAAGTCAATGGTGCGTGAGTGCGAGTGAGTAGGAAGAAAGCAAAAGCGATTGGAT
      TGATTTGTGACGCTGCTGGCGAAAAGCAGTACCCAGTACCCCTTTCCTTGGGCCAAAACACACACATACGTACGGCTATA
      GTAACTCAGCATCGATTGTACAGTTTGAGAGCAAACAATTCAATTAGAAAATGCAGAGCGCATGAGTTGAATTGTGAGTG
      GGCGCCCCACATAAGCTGACTGCTACCGCACAACGAAGGGAACTAGAAAGAGGAGTGCGTAGTGCGGAGAGAAGAGCAAA
      TGCGAAGCGAAGAGGAAGAGAGCGAGAGAGAGCAACCATTGCCAAAGATTAGTTACTTAGATTATTATATCAACGGATCA
      CAAAGGGAACCACAAATATTATAATGACATCTAGACTTGATCGGCTGTTCATTCTACTGGAGACGGGCTCTACAGCGGCC
      ACTCGTCAGGCGGCCGCCAAGCAGATTGGTGAGGTTCAAAAGCTTTATCCACACGAGCTGCACGCTCTGCTGAACAGATT
      GGTGGGCTACCTGCACAGTACATCCTGGGAGACACGGATAGCTGCAGCCCAGACCGTTGAGGCCATATTAAAGCAAGTAC
      CGCCCTGGCAGCCCGAATTCCAGGTGCTGCCCAAGAAGGAGCGTTGCGCTACTAATACTGCCACAGCTGCAGCGGCAGCA
      GAAGAGGACAGTTGCCAGTCAAGTGGTTCCAACTCGACAACGGCCAGCGAGCGACTACTTAGCTTTGATGAGTTCGATCT
      GCAGCAAATCCTCCACAAAGGTGCCAGACTCATCGGCTCCGAGGGCAACGAGTTTGATGTGCAGGAGGAGCAACCGGCTA
      GTGGAGGCGGGGAGGAGGACAGAAGCCTAGCCAGTCGTCTAAGCCGCCAGCGTGCGGTGCTGAACGACAAACTGGGTCTG
      ACAACGGCCGCCAAACTGGGCGTTAATCTTACCGATATGATAACAGACGAGGATGTGGCACTCAACAGGAGTGGCAGCAC
      TTACAATGTCAACGCAGAAAAGCTTCCAGTTGAGCACTTACTCAACATAAAGACAGCGGCGAACGGATCTGGTCAAGCTC
      CACTTAGTTGCCGTGAGATGAACAGGGCCAAGCGCAAGGCTCGTCAAAATACAAGCGGATGTTCTGTCACTGCAGTTACG
      CCAACTTGCAGCCGGAGGAACTCCAACAGCAATCACAGTACTGGCAGCAATCACAGCAGTAATGGCACCACTGGTGCTGC
      AATAGAAGAACCCGAAAAGAAGAAACTTAAGTCAACGGATCGGCAGGAAATCTTCTATAGTTTAAATGCTGCTGTGCCAG
      ATGCTACAGGCACTTGGGTGGATGCCGTCTCCTGGCCACTGGAGAACTTCTGCTCACGTCTCTTCATTGATCTCTTTCAC
      GCCAAATGGGAGGTGCGCCATGGGGCGGCAACAGCTCTAAGGGAACTGATTAATCAGCACGCTCAAGGAGCGGGAAAGGC
      AGTGCTACAGACTCGCGAACAGATGGATGAAGCACATAGCCGATGGCTAGAGGATGCTGCCCTGCGCCTGCTCTGTGTGC
      TTTGTCTGGATCGGTTTGGTGACTTTGTCTCGGATCAGGTTGTGGCACCGGTTCGCGAGACCTGCGCCCAAGTGCTGGGT
      ACGTTGGTCAAGGAGATGGAGGCGTCCAAGGTTCAACGAATCGTGAACATTCTGCTTCAGCTCATCCAGCACAAGAACGA
      GTGGGATGTGCGGCATGGTGGACTACTAGGCCTGAAGTATGTGTTTGTGGTGCGTGAGGAGCTGCTGCCCATCTATTTGC
      CCCAGTCAATTTCAAACATTCTCATCGGCCTGCTGGACGCTGTGGATGATGTCGGAGCGGTGGCTGCCGCAACCCTGATT
      CCAGTTTCTTCCTGGCTGCCGAAGCTATTAAATCCGGCGCAAGTATCTTCCATCGTAAAAATGTTGTGGGACCTACTATT
      GGATCAAGATGAACTCACGTCTGCCTGCAACAGTTTCATGGGGCTGTTAGCGGCCATTCTATGCCTACCAAACGCTGCTC
      GTTGGGTAGAGATGGAGCCGATGGCCATTTTGGTACCGCGCCTGTGGCCTTTTCTTTCCCATAGCACTAGTTCGGTACGA
      AGATCAACGCTGAAGACGCTTATGACCCTGACGAGTGCGGATAGGGTCAAATCCGAGCCCAAAGACGAAAATCAAGTTAA
      AGAGGAAGCGGATAAGGAAGAAATGAAACTTAACTTTGGAGTCAGCGACTGGAAGTGGGAATTGCTGCAGCAGGCCCTGC
      GTCACATATATCAACGCATCCTAGTGGAGCCGCAGGCGGATATCCAGGCATTAGCCCGTCAGGTGTGGTCCAATCTTATC
      CAGCATGCAGATTTGGGTGCGTTGTTGCATGCTGCCTGTCCATTCGTGTCGTCCTGGATATGCCTTTCAATGCAGCCACC
      TAGATTGGCTTTTGATGCAGGGGTCCTGATCAGAGCTGGTGGAGATGTAAGCACGCCAGGAAGCACCTCCCGAAAACGAA
      CGCCCCGCATAGGAGACGAATTGGGCGGTAACATTCTAGCGCAATCAAACGCCTCATTGAAATTATACCTTGGTGGTAGC
      GAAGCCACGCCTTTGGATGTCCGGGATGCCAATTTTATGCGAGCCCGGATTTCCTCATCTCGGGCACTGGGTGCACTTTC
      TCATTACCTGGTTCAGCCAGCACCGGGAGTGGTGTATACCCCACAAACGGAGAGTCCCACAGACTGTTATACAAAAGTAC
      TATTGGGTCATTTAAATGCCCACTCTGCTGTCCAGCGAATCGTCTGCGGGCTGATCATTGCGTTTTGGGCGCTAGAAGAC
      GAGCCAGTTCGCCCAGGACCGCCCAATCTGCAGGAAAAGTTACACCAATGTGTGAGCGAGTACGTCTACTACGATGAGGT
      AGCCATCTCACTGACCCGACTACTACAAGAGGCACAAGACTTTATTGCTACGCTGAAGCAGAACAAAATCCCGATTAACG
      ATTTCAATAATGCCAAGATCCTTACTCTAGATCAAATCGAGGCAGTGGCAACTACGCTAAGCGAAAATCTGCGTTCTTAT
      CCCCTCAAGCCGAAAGTTTTAGATATGCTAGAGGAGCGTCGACGCAGCCTTCAGGCCTCCTACCAGCAGACAACCAGTGA
      GCAAAGCGCCTATCATGTCAGTGCTCAGGCAGCACTCGCTGGCGCCATCTGCGCTCTTCACTGCCTGCCAGATAAGCTGA
      ATCCGGTGGTCAAGCCATTAATGGAGTCCATCAAGCGGGAGCAGTGCCTCCAGCTGCAGCAGCTGTCTGCCGAGTTCCTG
      GTCCACCTTATGGATCAGGTCTGTGATAGAAATCCTAGTCCAAATAGCAAGATTTTAAACAACCTTTGTACGCTGTTAAG
      GAGCGATCCCGAATTCACTCCCAAACTGGTAATGCCACTAGAAACCCTCAAACAGACGCCAGTTTCGTCTGAGGTTATTA
      ATAATTGTGTTTACTATGGTATCCTAACACTGGCACTTCAACAGACAGTGACAACCACTAACACGCGAAGCGGTGCGGGC
      GGTGCAACAACTCCCACTGCTACTACGGCCCCCAGGGGCCCTGGGCGACCGCCCACTGGCGAAATATTGTCCGCAACCAA
      CGCCACTGCTCACATTGAGCTTAAGGCGCAGCAAGCCAAGGAGGCGGAGGCGAAGCAATGCCGCATACAGCGCCTGGGAG
      CGGCATGTGCCATTGAAAAGCTGTGTAGGATATTTGGAGAGCAAATCATTGAAAAGGTGGCTGTTTTCCAACATCTGATG
      TTTGGCAAGGTGGAGCAGTTCGTAAAAGAAGCGTACGACTGGCGATTGGGCAGCCTTCTTCCAGATCTGGGAGTGTGCAA
      TGAGCTTGTCAGCTCTATGCAGCTTATTGAGACAGCAGCCCCCCATCTGCATGTTGCACTGCATCCTCAGATGTTTGCCC
      TTCTGCCCTCCCTTGGCTTTATCGTTTGCCATCCTCTTAAGGCAGTCCGACACATGGCCGCTCGTTGCATCGCCGTGCTG
      GCCGAGATCGATGCTTGCCAGACTATGCAGTTTGTGGTTCACGATCTGTTACCGCTGCTTGGGAAGATTGAGCAACTTAT
      AGAGCGACAAGGAGCCATAGAGGCTATCGAACGCGTGGTCAGCAGGCTGCAGATAAAAGTGGTGCCCTACATCGTGCTGC
      TGGTGGTGCCTCTACTGGGCGCAATGAGCGATCCGGATGAGTCAGTGCGATTGCTTTCCACGCACTGCTTTGCAAATCTA
      GTCCAGTTAATGCCTCTGGACGGAAAGACGGAGCAATTAAAAAGCGATCCGCTGCAGGCGCGCAAAACGCGTGACCGTGA
      GTTTCTCGACTATCTTTTCAATCCAAAGAGCATTCCCAATTATAAGGTTCCGGTACCAATAAGTGTGGAGCTGCGCTGCT
      ATCAACAAGCCGGCATCAACTGGCTGTGGTTCCTGAACAAATACAATCTACACGGCATTCTTTGCGACGATATGGGGTTG
      GGCAAAACTCTGCAAACCATATGCATCCTTGCCGGAGACCACATGCACCGTCAGACAGCCAATTTGGCGAATCTGCCTAG
      TCTCGTCATTTGCCCACCAACTTTAACCGGTCATTGGGTGTACGAGGTGGAGAAATTCCTTGACCAGGGATCCGTTCTGC
      GTCCCTTACACTACTACGGATTCCCAGTGGGAAGAGAGAAGCTAAGGAGTGATATCGGAACAAAGTGTAACCTGGTTGTG
      GCATCGTACGACACTGTGCGCAAGGACATCGACTTCTTCAGCGGAATACACTTTAACTATTGCGTTTTGGATGAAGGCCA
      TATTATTAAGAACGGAAAGACAAAGAGCTCTAAGGCAATAAAGCGATTAAAGGCAAACCATAGACTGATCCTCTCCGGCA
      CTCCCATCCAGAACAATGTGCTCGAGTTGTGGTCCTTGTTTGACTTTTTAATGCCCGGCTTCCTTGGCACTGAGAAGCAG
      TTCGTGCAACGCTTTTCACGTCCCATTCTGTCATCTCGGGATGCAAAGAGCTCTGCCAAGGAGCAGGAAGCTGGAGTGCT
      GGCCATGGAGGCGCTGCATAGACAAGTTCTGCCCTTCCTGCTGCGCCGTGTTAAGGAGGATGTGCTGAAGGACCTACCGC
      CAAAGATCACCCAGGACTTACTTTGCGAACTGAGTCCGCTCCAGCTTCGACTGTATGAAGATTTTAGCAATAAACACCTG
      AAAGACTGTTTAGACAAACTGGGCGACTCGTCGTCGGCATCCATGGTGACGGAGAATCTCAGCGCCAAGACACACATTTT
      CCAAGCGCTTCGATACCTGCAGAACGTATGCAACCATCCCAAGCTGGTGTTGCGTCAGTCTGAGGAGCTCACGAAGGTGA
      CCAGTCAGTTGGCGTTGTCAAACAGCTCATTGGACGACATTGAGCACTCTGCAAAGCTGCCCGCCTTGAAGCAACTTCTC
      CTAGACTGCGGCATTGGTGTGCAGACGGAGTCGGTGAGCCAGCATCGTGCCCTAATCTTCTGCCAGCTGAAGGCGATGCT
      GGACATTGTGGAACAGGATCTATTGCGCCGCCATCTGCCCAGCGTCACATATCTGCGGCTGGACGGCAGTGTACCCGCCT
      CACAGCGACAGGATATAGTCAATAACTTCAACAGCGATCCCAGCATCGATGTCCTGCTCCTGACCACTATGGTTGGCGGC
      CTGGGTCTAAATCTAACAGGCGCCGATACGGTCATCTTTGTCGAGCACGACTGGAATCCAATGAAGGATCTGCAGGCTAT
      GGACCGCGCCCACCGAATCGGCCAAAAGAAAGTAGTAAATGTTTACCGGCTGATCACACGCAACTCGCTGGAGGAAAAGA
      TCATGGGGCTGCAAAAGTTTAAGATACTCACCGCCAACACTGTGGTGAGTGCGGAGAACGCTTCGCTGCAGACAATGGGC
      ACCTCACAGATCTTTGACCTCTTCAACGGAGGGAAAGACAAGGGAGCAGAATCTGGATCATCAGCGGTGCAAGGAACAGC
      ATCGGGCGGCATGTCCATGAACACCATTATCGAGAACTTGCCGGAACTCTGGTCCGAGCATCAGTACGAGGAAGAGTACG
      ACTTGGGCAACTTTGTGCAGGCACTGAAAAAGTAGACTACTGCTTCCCACTCTAAGACTTCCAGTTTTAGGCTACGTTGA
      TCATTTATATTGCCCTCTGTTCCTTTATAATCGCGAAAAGAAACTTTTAGAAATAAATATTAATAAAGCTTGAAACTAAA
      T
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0344471
      6054
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0290929
      1923
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0310842
      1923
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Hel89B-RB
      Secondary FlyBase IDs
        References (0)