Open Close
General Information
Symbol
Dmel\CG3662-RC
Species
D. melanogaster
Annotation Symbol
CG3662-RC
FlyBase ID
FBtr0301908
Feature type
Associated gene
Evidence Rank
Length (nt)
1570
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 188 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GAATTAGAACTGGTCACACTGGCTTGTCTGGATCGAGATTTCAGCTCGTCAACAATTGCGCACTAAATTTTCAGTAAAAA
          CAAACAAGTTGGTCGTGCGGAGGCATCAAGAACACAGCATACGAGCAGCCATGACAATTCTGGGAAAACTGCGGGGACAG
          CCCACGGACCAGGAGAAGGTGCCCCTGCCCATGAACCTCAACGACGAGGCGCTCATGCACCATGGCTCCCTAATCGCACC
          CAAGGTTGCTTACAGCGATAATGAAGCCGACGCGGAATCCATGGTCTTCAACCGGCCGCAGCACCATTGCATCAAATCCT
          TTCTGCTGTTCCTGATCGCCGTAGTCGTGATGCTCCTGGGTGTCCTGGGCGGATGGACCCTGTACCGAGTGTACGCTCCG
          TCGCATAGCAGCATGCGCTACCACGCCCTGTGCGAGATCCCCTATCCGGAGGACTCGATGGAGATGGCGCGGGTATATCC
          GCGCACCGTGGAACCGTTCGCCCTGAACTGGCGCTCCTTGCTACCCGAGCTCGCGCAACCGATGCCCAACAGTGGATCGC
          TGGACGAGAGCCACTTCCGCGAGGACATCGAACTGGACGGTGACAGCGATGACGAGGGCTACGCACGCGTGGACGTGCCC
          GACTTCAAGGATGGACGTCGTGGTCGCTTCATGCACGACTTCAAGGAGAACCAGTCGGCCATTATCGACACTACCACCGG
          ACGGTGCTTCATCATGCCCTTGGATCGGGACACGACCCTGCCCCCGACCAGCTTTGTGGATCTCATAAAGAAGATGAGCA
          CTGGCTACTACAACATAGATACGGAGCGCGTGCGGCGCCAGATGCGTGTGGTCATGCCCCGCATCACCGATGTCTCGCTC
          ATCTCGGAGCGGATTGCCAACGAGTGCTTCGATATGAAGGTCTACATGATGGAGAAGTTCGTCTCAGGCGTCTCGAAGAG
          ATCGGCTGATCCGCTGCCGGAGTCAGCCAAGTACGCCGAGTTCATGGGCAAGGGCGTCATCGAGTACGACCTGGCCAACA
          TCGCCGAGGTGGAGGCCTACGAGGCCAACGAGGCTAGGCAACAGGCCTGAGCTTTGGAGGAGGAGGAGGATCTTTTAAGC
          TACAACACCCATATGATAACACAACCTAAACAAATTATTACTTAGAATCGATTTATACATACACAGAGCCATGCCTACAA
          GTCTAGATCTGGTTACCACTGGTTAGCAGGACACACACCCACTCCGGGTGGATATATCATCATTGGCCAAGCGAGTTTAG
          CAAATTATAGACCCTAGTAAGGAAGCGTAACGAAAATGTACCTAGAACGCAATCAAAAGCGATCGACGAAATTGTGACAA
          ATACGTGAAATGTATTAGCCTCGAGGGCGGATTGAAAGGATACGGAGAGATTGGATCGGTACACGCGCACAGACACACTG
          CGGCATTCCAACAAAAACAACCTGAGGGCGGAAAACATGGCAACTATCAGCATGCGTAAGAGAAACAAGTAAATTAATCT
          AAATGTTCTTTAAACTACTTACATGTATTAAACGCGAATTTGTGATCTTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078012
          1651
          FBtr0100469
          2849
          FBtr0305507
          1731
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0291122
          319
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0077677
          319
          FBpp0099899
          269
          FBpp0293959
          319
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG3662-RC
          Secondary FlyBase IDs
            References (0)