Open Close
General Information
Symbol
Dmel\Tm1-RM
Species
D. melanogaster
Annotation Symbol
CG4898-RM
FlyBase ID
FBtr0301959
Feature type
Associated gene
Evidence Rank
Length (nt)
1253
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 204 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCAGTTGAACATCACAATCCGTTCAAGTCGCGGATAACTCCGAATAAAAGTTTTTTTCTTTCGAGTGCAGAGTAGCAAAA
        CAAAACAGACATGGATGCCATCAAGAAGAAGATGCAAGCGATGAAAGTCGACAAGGACGGAGCTCTGGAGCGCGCTCTCG
        TCTGCGAGCAGGAGGCACGCGATGCTAACACCCGCGCCGAGAAGGCCGAGGAGGAGGCTCGCCAGCTGCAGAAGAAGATC
        CAGACCGTTGAGAACGAGCTGGATCAGACCCAGGAAGCCCTGACCCTGGTCACCGGCAAGCTGGAGGAGAAGAACAAGGC
        TCTGCAGAACGCCGAATCCGAGGTTGCCGCTCTGAACCGTCGCATCCAGTTGCTCGAAGAAGACTTGGAGCGCTCTGAGG
        AGCGTCTGGGCTCCGCCACAGCCAAGCTGTCGGAAGCCTCTCAGGCCGCCGATGAGAGCGAACGTGCTCGCAAAATTCTT
        GAGAACCGCGCCCTTGCCGATGAAGAACGCATGGACGCTCTCGAGAATCAGCTGAAGGAAGCGCGTTTCCTTGCTGAGGA
        GGCTGACAAGAAATACGATGAGGTTGCCCGTAAATTGGCCATGGTTGAAGCCGATTTGGAACGTGCCGAAGAGCGTGCCG
        AGCAGGGTGAAAACAAAATTGTGGAGCTTGAGGAGGAGCTGCGCGTGGTTGGCAACAACCTGAAGTCCCTGGAAGTCTCT
        GAGGAGAAGGCCAACCAACGTGAGGAGGAGTACAAGAACCAGATCAAGACCCTCAACACCCGTCTAAAGGAGGCTGAGGC
        TCGTGCTGAGTTCGCTGAACGCTCCGTTCAGAAATTGCAGAAGGAAGTCGACAGGCTCGAAGACGACCTCGTCCTGGAGA
        AGGAGCGCTACAAGGACATCGGAGACGATCTCGACACCGCCTTCGTCGAGCTCATCCTCAAGGAATAAGCGACAACCCGA
        CCTTGACGGACCCTCGCACCCAGACCAAAATCGATCCGCACAGCTATATTTTTGGGCGGCACACCTTTCGATTGTTTGTT
        ACTGTAGTCGCATAATCGTAGGCCCACTGTACTTGTATCTAGTAGCCTGCACTTTTGATTTGTGTGTTCGTAGATGGATA
        GTTTGTAGATTGATTTTGATCGCGGACCAATTAGAGGGAAGCATCGATGTAATTGTGTATTTGTTTGACTCAAACGTTTT
        TTATTTATTATTTGTATCCAAACTAAGCAATAAAGCAATCAACTTAAAAACAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0089960
        2003
        FBtr0089962
        2651
        FBtr0089965
        2531
        FBtr0089959
        1684
        FBtr0089964
        2485
        FBtr0089963
        3054
        FBtr0089961
        2501
        FBtr0089967
        1248
        FBtr0089957
        1665
        FBtr0089968
        2194
        FBtr0301960
        1253
        FBtr0305654
        1503
        FBtr0305655
        752
        FBtr0305656
        1318
        FBtr0333917
        1861
        FBtr0333918
        1253
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0291171
        285
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0088899
        252
        FBpp0088901
        441
        FBpp0088904
        711
        FBpp0088898
        501
        FBpp0088903
        285
        FBpp0088902
        678
        FBpp0088900
        441
        FBpp0088906
        285
        FBpp0088896
        518
        FBpp0089024
        284
        FBpp0291172
        285
        FBpp0296934
        285
        FBpp0296935
        161
        FBpp0296936
        250
        FBpp0306045
        250
        FBpp0306046
        285
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Tm1-RM
        Secondary FlyBase IDs
          References (0)