Open Close
General Information
Symbol
Dmel\RhoGAP1A-RC
Species
D. melanogaster
Annotation Symbol
CG40494-RC
FlyBase ID
FBtr0302200
Feature type
Associated gene
Evidence Rank
Length (nt)
4254
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 14 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    GACGAATGGACGTATACGAATACGCGTCATTCATACATAAATAATATACATAAAATTTAAAAATATCTGTAAATATAGTT
    AAAAAGTTCCATTTATATATGTGTTACGGATAACCGCCTGTTTAATAGCCTAATTTGAAAAAACATAAAAGCTACAATAA
    CAAGGCATTACGTAAACTATTAAAATTTTTTGTACGTTCAAGAGCTAAGTACCGAGCTTTTTTTTCATTTCCGCGCAAGT
    GTTTGTTAACGTGTTTTCGCTTGAATCAAAACCTATCTCCCAGTCATAGACACTTCGTCTTTGTTAACCCCTAATTTCCC
    ATTCAATTCAATCAATTTTTATACCATATCAAAGGAAAAATAGCTCAACAAAGTGGCGCTGAATTTTAAGCATGGCTTCC
    TTTAAGGAGAAGTTTAAATTATGGTCCAGAGGGGTGCGTAAGAGTAATTTGTTGAGAACGAGATCTCTACTGCAGATATT
    ATATATACAACATAACGAACTTAAAAATGGAAAACGCTACATAAGCTACAACAATTTTAGCTGTATTATGACAAGTTGAA
    ATCAATAAAATACTTATCGCAAAATTCTATATAACTACGCGCATACACGTAGAATCCGTGCCTATATCGTTAGGTCTCTT
    TTATCTATAAGTGTATATACTATCTTGAAACCAAAGAATTAAGAAATACCACCAAAAAAACGGAGCTTCCAATTTTCTCT
    ACAGCTCTAGCTGTCGACCTTTTTGGGCTTTAAATTGCACGCTTTCTTCATTTCTCCGCTCTCATTTAACCAACCACCCA
    CTTGGATATGGATATCCACCTCGATAAGCAAACAATTTTTGGTTGGACATTTTTCACTTCTTGAAATCTAGTTTAAATCT
    GCGCGAGTCTCCTTCTTCCACTGGCGCCAAGGACAAGGATCGCCTGTCGCTCAACCCAGACAACAAATACACAACACACA
    CAAATGCCGTTATAGGTGGGATCGGATCGGAAAAGGTGAGCGGTCCACTTCACTCCACTCAGATCACGGCGGACGGCAAA
    CGAACAGGGGAGCTGTATTTAAAGCGGGAAGAAGACAAATGCAAGGATAGTAATAGTGAGGACACCGATGGGGCCCTGCA
    GCAGTGCATCACGGAATTGGCGGCGTCTTTAAAAGCCCAGCCGGATAACGTGGCAGGAGGGCGTCTAGAAAACGATGTCG
    ATATCGATAAACCGCTGCGCAAGTCGACGTCACAATACGTTACTGTCATTCAGGTCAAAGAGGCCAAAGACAAAGAAAGC
    GCTGATGGAACTACCTCGTCATCGGGGATCGGTGAACCGCAGCAGCAACCCACTCCACCATCCACATTTTCTCGATATTC
    GGAGGCCACCGCTCCACCGCTTTCGCCATCGCTCACATCGTACGCTGCCCACGTAGAGGCCAAGAAGAAAATGCCACCCA
    GACCTCCGCCAAAGAATATTCGGCGAGTTGAGCCCCCTACCATTCCCAGCCAGCAGCTATCGTCTTCGCCCAAAAGGGAG
    ACATATATGATCAACACGATGCCAAGCAGTTCAAGCGGCAGTCTCTGCATTGACAGCCTGGGCAATTCGCTGGAGCGGAA
    CATCAAGCCGTCTGATATACTACGTCAGAAATCATCTGATAATTTGGATTCCAAGTACTCGGCAAAACGGAAAACCACAC
    CGGAGCTTAGTAAATTTGTGAACGTAAACAATCCTGAATTAATGGAGGAGCTCGGTCGTAAGATGGTAAGCAAGGCAGAC
    AGCCTGGAACAAACGAGGAGGAACGACTCGTCGCCTTCTGGCTGTGGTAGCCTAGGACGCACTTCCTCCACGCCTGGGCG
    ATCGTTGACTCCTGGACGAACCGGAGTTGGTGCCTCGCCAACTGGTAGTCTAAGTAAAACCGGAAAACTGGCAATGGCGG
    ACAGCAGCTCCACTAGCAGTCTAGAGAGGAGATCGTGCCTGCAGGCTGTCGATGCGGACATTGGAACGGAATCGCGGGAA
    TCGGGTGCCAACCAGCGTAGTGTAGGGTCCAAGGAGTCGCTGACATCACAAGGCATATCGGAGGTGATCAAGAGCTACGA
    AAGCGTGTCTTCGCTAAGTTCGGAAAGTGCAAAGGCGGTGGCTTCCCAACAGTCGGCGGCAGCGGGCGGAGCTTTAGCGG
    AGTGTGAACCGTACTATGATAGCGTACCGCTCGACAACGGCGACGGAGAATACGTTTTTATTAAGCCCGGCCGCACCGGA
    TCCTCATCCAGTCGCGATGATTTGTCGACGCCTGGGAGCAGCATTTTGCCTTTGCCTAATGTAGCGGATCCCGAATCTCC
    AGGCAGGACCTCTAACTACGTCAACATCGATTTCTTCCTTCAGCAAGGAATTGAGACGCGCTCCAGTTCGCTAGACAGTG
    ACGGGGAGTACGAGGGTCCGCCCATATTACGCACCATTTCGCACGACGATCAAACCACAACACAAACTACTCCGGGAGCA
    ATTCGCAAGGTTTGTGGAAATGCGCGCGGTGCTAAAATACGTTCCATACTTAGCTCAATTATTCAAAGTGAGACTATCTA
    CGTGGAATGCCTCAATAAAATGATGCAGTACAAGAAGGCCATCCACGCAACCCTAACTACTTCGCAGCCTGTGATCAGGG
    AGGAGGAGGAGAACACAATTTTCTTTAAAATTGATGAGCTTTACGATCTGCATACCGGTTTCTTATCTGATTTAAAGACT
    ATTGTGTCTCACGAGGGTGGTGATGTGCTGATCGGTGAGCCGTTTCGTCGACTGGCGGAGATGTTTGACTTATACAGTGC
    CTTTTTGCACAACTACAAAAATGCTATTGAGACTGTGAAGAAGTGCAGTGCCAATAACCCCCAGTTTAAAAAGATCGTCT
    CCACCATTGTGCTTAATCTGCAGACGGAACAATCGCTAACTCTCGAGGATCTATTGCACAAACCTGTTGCGAGGGTACAA
    ATCAACGCATTGGTCTTCAACGATTTGCTACGCGAAACCCCAAATGCGCATCCGGATCACCAGCCATTAAGGCAGGCGCA
    AAAGATTATTCAGATGTTCCTCAATCAGTTCAATGTGGTCAATCAGCGGTTGCCCATTGAATCGAATCGAAATTTAAGAC
    GCATGGTGCGTAATTCTTTTATTGTAGAACTTGTCGATGGACATCGTAAGCTGCGGCATCTCTTTCTTTTTAATGATGTC
    ATCGCATGTGCCAAATACAAAGCATTAGGCCGCGATCGTATCGACTATGAGCTCAAATGGTTCATTCCGCTAAAAGACGT
    ATCCATTTACGAGGAAGCAGATCCGGCGGTCGAGCTTAAGGAATCTAGTCCAGCAAACATTTCGCAAGTAAAACGCAATT
    TGCGATCCGTTCGAGATCAATTGGCCATGGAGGTGGCTAACAGTGGAAGTGGAGCCTTCCGTTCCGGTGATAAGTATCGC
    CGCAAGCTGGCGGATCTGGAATCACAGCTGGTGCTGGCAACGCCCAATTTAGTGTTGCGCCTGGGGAACAAGGCAAATAA
    TAAAACCATAACCTTCTTTCTTAGCTCGGATTTTGAGAGGACGCAGTGGATCGACTCAATCTTATCCCTTAAGCAAAAAT
    GCAACCTGCCTGGAGCAAATACTATTAATTCCCTGGAGGTTACCGCCTTCATTGTAGCCATGCAGAAGGGCATGAAAACC
    GAAATGGGTTCATATCTTATGCGTAACACTAACGACGAGAGCCTGTTGGTTGGGGACCTGTACATGGGAGTTCATGGATT
    GGAAGGACTGGAGCAAGCGAACGACCTGTACATCTGCGTCGAGGTGGACTCCTATGGCCACTATTTTCGCAAGGCCACCA
    CCAAGAAGATATGTCGCAGTCAAACGCCGCTCTGGAACGAAAGCTTTATGCTGGAACTGGAGGGCAGCCAGAATGTACGC
    ATTCTTCTTTATGAGGCTAAGGAGCGACCGCTTCTTAAAGCCAAGCACATACTTAAGTTGAGTTTAAGTTGGCTGACAGA
    AACAACGCAGCCGAAGTCAATTAAACTTACTGAGACCTTAGAGCTCGGCTGTAGCTTCCGTTTTATACCAGGCGAGCTCT
    TCCGCGGCAGCACAAAGCCAGGAGCCCTCTTCGGTGCCAAAATGAGTCAAGTATTAAAGTAAATAATAATTCCATATATC
    AAATAACAGCACCCCTTTTCGTGAAATGAAAATTGTAAAGAAATAATTAAATATTTTAATAAACTTTGTGAGCAATATAA
    ATTAATGTAAAACT
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0112919
    5082
    FBtr0112920
    5012
    FBtr0340053
    5083
    FBtr0340054
    5089
    FBtr0340055
    3824
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0291410
    903
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0111832
    1403
    FBpp0111833
    1403
    FBpp0309060
    1402
    FBpp0309061
    1404
    FBpp0309062
    903
    Comments

    Transcript terminates at site supported by polyadenylated cDNA.

    Based on cDNA(s) that contain premature stop codon and/or downstream start; may or may not produce functional polypeptide.

    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (1)
    Reported As
    Symbol Synonym
    RhoGAP1A-RC
    Secondary FlyBase IDs
      References (0)