Open Close
General Information
Symbol
Dmel\Kr-h2-RB
Species
D. melanogaster
Annotation Symbol
CG9159-RB
FlyBase ID
FBtr0302212
Feature type
Associated gene
Evidence Rank
Length (nt)
1324
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 18 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CGTAGTGCAGTCTAATCCTGGAGTCATAGAGGGCAGATCTTGCGGGCTATTCATTAGGTTGGAACCCTCACACATCAGAT
      AGCGCCGCAGTTACTTAGCCAAGGTTCTCTTATCGCTGCCTATGCCTAAGATAGCAGCCAAATTCCCGCCGATAAGGCCG
      AAAGTAGAAACCTTATACTGATTTTCATAACTGCCTTGCAGACTGAATACTGAACGGAAAGCGAGCACGAAAGCTACTTC
      ATCATGAGCGCACCCACCGACCAACCACCGCGCTCCGAGGGCGCTCAGACCAACAGCTCCGAGAGATCCTCACAGCAGCA
      GGAGCAACCGCAGCAATCTCAATCACAGAACGTACCGGCCAAGCTCCTGCAGCATTTTCAGACAAATCGCATAGATTCCG
      CGCTATGGGCACTACGTCTGCTGGTCATCTTCTTCACCGTCAGCTACGTGCTGCCCATCTTTACCTCACAACAGAGCGCA
      TTCAGCAAGGTTATGCTGGCTAATGCCGCCATCTCTGCCTTGCGTTTGCACCAGAGATTGCCCGCGTTCGCGTTCAGTCG
      GGAGTTCCTTGCTCGACTGTTTGCCGAGGACTCGTGTCATTACATGATGTACTCCCTGATCTTCTTCAACATCCGCCCAT
      CGCTGCTGGTTCTGATTCCCGTGCTGCTGTACTCAGTTCTGCACGCCTCAAGCTACTCGCTTAAGCTGCTGGATCTGATT
      GGCCAGAACTCGTGGTGGGGTGCCCGTTTCATCATCTCCATTGTAGAGTTTCAGGCGGCGAATATCCTGAAGGCAACTGC
      ATTCTGCGAGATCTTCATCATGCCTTACGCCATTGTGCTGGCCTTCATGAACCACGCTGGATTGATGACGCCCGTTATTT
      ACTACCACTATCTGGTGATGCGCTACAGCTCGCGACGAAATCCCTATCCGCGCAACGCTTTCGCTGAGCTGCGTATAACC
      TTCGAGGCGCTGGCCGCCCGCTCACCGCCCGCCTTTGCCAAGATCATCCGTGGAGGCATTGGGTTCGTCAACCGCTTGGC
      GCCGCAGCTACAGCCGGCTGCAGCGCAAGAGTAGACACGACAAGCAGCTAACGGAAAACAACAATCAAATGACATATGAA
      TAAGGCTATTTAAATACCAGTTCACTTGCATAGATGTTCACACAGGAGATTGGGGTTCATCCGTTTTATTTGTTAGCCGA
      AATTCGTTGCACCTTTTCGAAGCGAAACTAGTTGTTTTACACCAGATTGTTTCGGCATTTAAGTTTAAATTTATCTATAT
      ATTATTGTAGTTTTTTTTGAGTACATCATCATGCTTTTTTCAAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0079192
      1570
      FBtr0343126
      1491
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0291422
      276
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0078823
      276
      FBpp0309826
      276
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Kr-h2-RB
      Secondary FlyBase IDs
        References (0)