Open Close
General Information
Symbol
Dmel\AANATL7-RB
Species
D. melanogaster
Annotation Symbol
CG13759-RB
FlyBase ID
FBtr0302447
Feature type
Associated gene
Evidence Rank
Length (nt)
990
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            TTTTGAATCAAATTCGTACGCTATGAAATTAACTATCCCACTCAAAAACCCAAATCGGCACCATCATCAATAGTATGAGT
            TTCAAGAGGTTGGCACCACAGATCCTTAAGCATCCGGGATGGCGTGGTAGAGCCACTGGGATTCCCCGTTTCAAGATCTT
            CTTTACCATCCGCAGACAATTCGGCGATTGCAGCGGCTGTGACACCATGGAGTACAAGATGATTGCACCGGAGCACAGTG
            AACAGGTGATGGAGCATCTGCGGCGCAACTTCTTTGCCGACGAGCCGCTAAACAAGGCCGCCGGCTTGTGCCAGAACGGC
            AGCAGTTGCCCCGCCCTGGAGGCGCACTGTGCCGAGGCCATACAGCACCGGATGAGCGTGATGGCTGTGGACGCAAAGGA
            GAAGGATACCTTGAAAATAGTCGGCGTCGTCCTCAATGGCATCCTGAAGCCGGGCGACACGGCCAAGGCGCTGAGCAAGC
            TGGACTGCAACGACGATGCAGATTTCCGCAAGATTTTCGACTTGCTGCACAGGCACAATCTCAAGCACAATCTCTTCGAG
            CACTTCGACGTGGACTGCATGTTCGATGTGCGCATCCTATCGGTGGACTCGTGCTACCGTGGCCAGGGGATTGCGAATGA
            GCTGGTCAAGCGGTCCGTGGCGGTGGCCAAAAAGAATGGCTTTCGCCTGCTGAAGGCCGATGCCACCGGCATCTTCTCGC
            AGAAGATCTTTCGTTCCCATGGCTTTGAGGTCTTCTCGGAGCAACCCTACAGCAAGTATACGGATGAGAATGGCAAGGTG
            ATCTTGCCCGTGGAGGCGCCCCACATCAAATTGCAGCAGCTCTACAAGGCGATCTGCGCGGATGACCAGGATGAGAAGAA
            GCAGTCGCTTTAAGGAGTCACCCGGCTGGCTCACATTTGGAACAATAATCTCATTTATTTTCTACATATACATACATTGC
            ATAATCGTTATTGGAATGTTTTCGTACTAC
            
            Other Products of this Gene
            Other Transcripts
            Name
            FlyBase ID
            Length (nt)
            FBtr0070437
            958
            FBtr0302448
            938
            FBtr0302449
            934
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0291635
            228
            Derived from OTHER transcripts
            Name
            FlyBase ID
            Length (aa)
            FBpp0070421
            228
            FBpp0291636
            228
            FBpp0291637
            228
            Comments

            Transcript terminates at site supported by polyadenylated cDNA.

            External Crossreferences and Linkouts ( 1 )
            Crossreferences
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (2)
            Reported As
            Symbol Synonym
            AANATL7-RB
            CG13759-RB
            Secondary FlyBase IDs
              References (0)