Open Close
General Information
Symbol
Dmel\CG8026-RC
Species
D. melanogaster
Annotation Symbol
CG8026-RC
FlyBase ID
FBtr0302511
Feature type
Associated gene
Evidence Rank
Length (nt)
1489
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 30 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CCGAGAGCGGGTTTCTTGATTATTAAATATTGTTGCCGTCCAGTTTGCCCGGATCAGTGCTAAAAATCGTTAACGCATTA
      ACGATGGCCGGACAGCTACGGTGCCGCAATACCGGGGACTGAGCAGCGCCTTCACCACGATTTTCCGGCAAGAGGGCTTC
      CGCGGACTCTACAAAGGCGTCACCCCCAATGTCTGGGGATCGGGCTCCTCTTGGGGCCTGTACTTCATGTTCTACAACAC
      CATTAAGACATTTATCCAAGGAGGAAACACGACCATGCCATTGGGCCCCACAATGAACATGCTTGCAGCTGCTGAGTCGG
      GAATTCTCACCCTGCTGCTGACCAACCCCATCTGGGTGGTGAAGACGCGTCTCTGCCTGCAGTGCGATGCCGCGAGTAGT
      GCCGAGTACAGGGGCATGATCCACGCCTTGGGCCAGATATACAAGGAGGAGGGAATCCGTGGCCTGTACCGCGGCTTTGT
      TCCCGGCATGTTGGGCGTCTCCCACGGAGCCATCCAGTTCATGACCTACGAGGAGCTGAAGAACGCCTACAACGAATATC
      GCAAACTGCCCATCGACACGAAGCTGGCCACCACCGAGTACTTGGCCTTCGCGGCTGTCTCCAAGCTGATCGCAGCGGCG
      GCCACCTACCCGTACCAGGTGGTCCGGGCACGGCTGCAGGACCACCATCACCGATACAACGGCACCTGGGACTGCATCAA
      ACAGACTTGGAGGTACGAGCGCATGCGAGGTTTCTATAAGGGCCTGGTGCCCTACCTGGTCCACGTCACGCCCAACATCT
      GCATGGTCATGCTGATCTGGGAGAAGCTGACCAGCTAGATGGAGTATTAGTACTAGATCATCGAATCTGGAATCTGACAG
      AGAATTTAAGCTAAGCACCTAGAATACACGAATCTTTCTCGTTTCCTCCGATGTGCAGCTAACAGCAGAAAATGACAAAC
      TTATTCTGTATTATTGTTGTAACTCGATTTCGGTTTAGCCCTAGCACCTTACTTTAGCCTTAAGTGTATTCCATATCTAG
      TTTATTGTACATCCTTCACTCCCAACTTCGAAAGTAACTGATGTGATCGGGGCGTCGTCAAAATAGCCCCTGCCCATGAA
      ATGTAATTTCAAAAACGCATTTCTTGCACTCTTCATCAAAACAAACACATATTTAGTTCTTAGTTTAGTTAAATTATTTA
      TTCTATAACGGCTTGGAATTGTGTAAGCACAAAGAAAAACCAGTTACTGTTTAGTTGATACAAAATTTCGTTTTGGCAAA
      AAGATTCTTCATAGTTTTTGAAAATGGTTTATAATTTTAAGGATAAACCTTGACATTTATGTAAATAAGCATAAACGCAT
      TGTGAAACCAACTTAGTCCTACAGTGGAACAATCTTATTGAAATCAAAGAAAAGATAAGAAATGCGAAATTACTTACCCA
      TATTAAAAGGCCACGATGGCAGACCTAAATGAAAACCAAGAAACAAACT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0088611
      2926
      FBtr0302512
      1941
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0291673
      203
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0087692
      304
      FBpp0291674
      322
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Monocistronic transcript; alternative dicistronic transcript(s) exist.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG8026-RC
      Secondary FlyBase IDs
        References (0)