Open Close
General Information
Symbol
Dmel\CG8026-RD
Species
D. melanogaster
Annotation Symbol
CG8026-RD
FlyBase ID
FBtr0302512
Feature type
Associated gene
Evidence Rank
Length (nt)
1941
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 48 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AAAGTCGATTAGTCGTTTTTCGTTGGAGAGCTTGCTGTTCGCATTTATCCGCCTGCTCGCGCGTAGAAAAGTTGTTACTT
        AATGTTCATTGCTGCCACACGTGCTTGATTATTAATTGCAGTGCGCTAATCAGTCGCTTGTCAGCTGAGCAGACCACAAA
        AAACGAAGGCAATTATTTAGGCTGCCCTTTCAGTTCGGCATTACATAAGAAACGAATGGCCAAACGAAAATAATTTTGAA
        ACAATTTCGGAGTTAATATTGCATCAGCAATTCTGAACAGCAGATACACAAAAAGGGCAGCAATTTGGCCAACAAAGTCT
        TCATAAACGACAACAAACGAGTGAAAATATGAGCTGGGCAACAACAAAGCAAAGGCACAAATGTTTCAACTGTAGCAGCG
        GCAGCAACAAAAACAACCGGAGCAGCGGCAGCAGCAGCAACAACAACAACTGTGCGCCTAGCAACAAGATAATTTCGACG
        AGCGATTTCCTTTGATTTGCGCCCATCTGTGTCGAAAGCAGCCGAAAAGCCAAAGAGTGTAAATAGCACGTAGTTTTAGT
        ACAATTCACTGTAGCAAAAGTGAGTTTCAACCGGGGCAGCCAATAAGCCTGCGATAGCAACAATAATACAGAACGAGCGC
        AAAAGAAATCACCAGAGATTGCACAATATGAATCCGATCAAGGCACAGTCAACGGGCAGTCCCAAGAAATTCAACGTATT
        CGCACACGTCAAGTACGAGCATTTGGTTGCCGGAGTATCCGGCGGAGTGGTGTCCACACTCATTCTACATCCCCTGGATT
        TGATCAAGATTCGATTCGCAGTTAACGATGGCCGGACAGCTACGGTGCCGCAATACCGGGGACTGAGCAGCGCCTTCACC
        ACGATTTTCCGGCAAGAGGGCTTCCGCGGACTCTACAAAGGCGTCACCCCCAATGTCTGGGGATCGGGCTCCTCTTGGGG
        CCTGTACTTCATGTTCTACAACACCATTAAGACATTTATCCAAGGAGGAAACACGACCATGCCATTGGGCCCCACAATGA
        ACATGCTTGCAGCTGCTGAGTCGGGAATTCTCACCCTGCTGCTGACCAACCCCATCTGGGTGGTGAAGACGCGTCTCTGC
        CTGCAGTGCGATGCCGCGAGTAGTGCCGAGTACAGGGGCATGATCCACGCCTTGGGCCAGATATACAAGGAGGAGGGAAT
        CCGTGGCCTGTACCGCGGCTTTGTTCCCGGCATGTTGGGCGTCTCCCACGGAGCCATCCAGTTCATGACCTACGAGGAGC
        TGAAGAACGCCTACAACGAATATCGCAAACTGCCCATCGACACGAAGCTGGCCACCACCGAGTACTTGGCCTTCGCGGCT
        GTCTCCAAGCTGATCGCAGCGGCGGCCACCTACCCGTACCAGGTGGTCCGGGCACGGCTGCAGGACCACCATCACCGATA
        CAACGGCACCTGGGACTGCATCAAACAGACTTGGAGGTTTGAGGGCTACAGAGGCTTCTACAAGGGGCTGAAGGCGAGTT
        TAACCCGAGTAGTGCCTGCCTGCATGGTCACCTTTCTGGTGTACGAGAACGTCTCGCATTTCCTGCTCGCCAGGCGGAAG
        CGAATTGAGACTAAAGAGGATGCGTCGGACGTGTGATTTTCCTTTGGTTGGATTCCTTTTAGGCTTCTAAGATACATATA
        TCACCTCACGACATTTCCATATGTCTCTATAGTCAGCGGGCAGTTGCAATCGTGCTGAGCATGCGCAGCTGCTTTTAGTT
        TAAGTTTAGTTAGTTGTTGCGAAGACTTATTTGGTCTTTTCGTAGTAAGTAAAGTGATTGTTGTTCCTAAGTGTGGATCA
        GAATGGATTTGTGATTGAATTCAGACGAAAGTGTTACAATATACCTGTGAAATATAAGTCCATAGCCTCACTCTTGCAAA
        TAAACCAAATCTTTGTGAGCC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0088611
        2926
        FBtr0302511
        1489
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0291674
        322
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0087692
        304
        FBpp0291673
        203
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Dicistronic transcript; alternative monocistronic transcript(s) exist.

        transcript_exception: dicistronic_mRNA

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG8026-RD
        Secondary FlyBase IDs
          References (0)