Open Close
General Information
Symbol
Dmel\RpL3-RG
Species
D. melanogaster
Annotation Symbol
CG4863-RG
FlyBase ID
FBtr0302586
Feature type
Associated gene
Evidence Rank
Length (nt)
1688
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 777 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      Sequence
      TTTCTTTTCCGTTTTACACGTCTGAAGAGAACAGACATGTCTCATCGTAAGTTCTCGGCACCCCGCCATGGCTCCATGGC
      CTTCTACCCCAAGAAGCGCTCAGCTCGCCATCGCGGTAAGGTTAAGGCCTTCCCCAAGGATGACGCCAGCAAGCCAGTCC
      ATCTGACCTGCTTCATCGGCTACAAGGCCGGCATGACCCACATTGTGCGCGAGGCCGATCGTCCTGGCTCCAAGATCAAC
      AAGAAGGAGGTGGTCGAGGCCGTCACCGTTCTGGAGACCCCGCCCATGATTGTGGTCGGTGCTGTCGGCTACATCGAGAC
      TCCCTTCGGTCTGCGTGCCCTGGTCAACGTTTGGGCCCAGCATCTCTCCGAGGAGTGCCGTCGTCGCTTCTACAAGAACT
      GTTCTTCGATCAGCTTGCTGAGAGAGCTTTTCAAATCGCTAAACGTTGTGTGAGCTGTCAGGTTAATCTTGATCATGGGG
      CGCACAAGCAAGCCCCTGGTTAATTGAAATTGCCTGACGAGTGAGCATGACAAGGAAGACTGCATCTCCGCTCGCCATTC
      GTTTGCGATGAGGCGCACTTCCTGTTCTATCTCGCCCCACATAAACAGCGCGGCTAAGAAGTTGGAGTTGTTGCGACACC
      CCAATGGATTGCTACATTACGCTCGTTTCTGACCACTGCGTCTCCAACTTGACCATCGTCCATATCAGGTACAAGAGCAA
      GAAGAAGGCATTCACCAAGGCCAGCAAGAAGTGGACCGATGATCTCGGCAAGAAGAGCATCGAGAATGACTTCCGCAAGA
      TGCTGCGCTACTGCAAGGTGATCCGTGTGATTGCCCACTCGCAGATCCGCTTGATCAAGCAGCGCCAAAAGAAGGCCCAT
      GTCATGGAGATCCAGCTGAACGGCGGCTCCATCGAGGACAAGGTCAAGTGGGCTCGCGAGCATTTGGAGAAGCCCATCCA
      GGTCAGCAACGTCTTCGGCCAGGACGAGATGATCGACTGCGTTGGTGTGACCAAGGGTAAGGGTTTCAAGGGTGTCACCT
      CGCGTTGGCACACCAAGAAGCTGCCCCGCAAGACGCACAAGGGTCTGCGCAAGGTGGCCTGTATTGGTGCCTGGCATCCG
      TCGCGTGTGTCCACCACCGTGGCCCGTGCCGGTCAGAAGGGTTACCACCACCGTACCGAGATCAACAAGAAGATCTACCG
      CATCGGCGCTGGCATCCACACCAAGGACGGCAAGGTCATCAAGAACAACGCCTCCACCGAGTACGATCTGACCGACAAGA
      GCATCACGCCCATGGGTGGCTTCCCCCACTACGGTGAGGTCAACAACGACTTCGTCATGATCAAGGGCTGCTGCATCGGC
      TCCAAGAAGCGCATCATCACCCTGCGCAAGTCCCTGCTGAAGCACACCAAGCGCTCTGCCCTGGAGCAGATCAAGCTCAA
      GTTCATCGACACCTCGTCCAAGATGGGTCACGGTCGCTTCCAGACCCCTGCCGACAAGCTGGCCTTCATGGGACCGCTCA
      AGAAGGATCGTCTCAAGGAGGAGGCTGCCGCTACCACCGCTGCTGCTGCCGCCGCCACCACCACCAGTGCTTAAACAAAA
      TGTCGTGTCCGCGTTCAATTGTCTGCTCGCTTCTACCACCAACTGCTGCGGTAGGGCAGCGATCAATAAACAGATTTTGG
      CTAAGCTG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0082346
      1381
      FBtr0082347
      715
      FBtr0336783
      1610
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0291742
      138
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0081822
      416
      FBpp0081823
      161
      FBpp0307759
      416
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Based on cDNA(s) that contain premature stop codon and/or downstream start; may or may not produce functional polypeptide.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      RpL3-RG
      Secondary FlyBase IDs
        References (0)