Open Close
General Information
Symbol
Dmel\CG42672-RJ
Species
D. melanogaster
Annotation Symbol
CG42672-RJ
FlyBase ID
FBtr0302706
Feature type
Associated gene
Evidence Rank
Length (nt)
4908
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 13 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGTTCACTGGCGGCACTCGATGCCCAACGTTCGTTTGACTCCAAATTGAATTTCGGCATACACACAAGTAGTATATCTTC
          TCCATCGATTGCAAGGCGGCCTTCAAGACGGAACTGAGCGGCGAGAGTTTGGCGAAAATGTTCAAATCCCGCCTAAAGAC
          GAATCCGGGTGGGAGTGAGAACATAAATCGCTTCGGAGACTCCATGGGTTCGCTGGGACATCGTGCCTTGTTGCAGTACA
          TCGATAATAATGATATATCCGGTCTGCGCGCCATTTTGGACAGCCGACATCTTACCATCGATGATCGGGACGAGAATGCC
          ACCACGGTGTTGATGGTAGTTGCTGGACGAGGCTTAACTGCCTTTGTTCGCGAGTTCCTGGCCCGCGGTGCCGATGTTCA
          AGCGGAGGATCTGGACAACTGGACGGCACTGCTGTGTGCCTCCCGAAACGGGCACTTAGATGTTGTCCAACTGCTGCTGG
          ACCATGGCGCTGAAGTGGAGCATCGCGATATGGGTGGCTGGACCAGTTTGATGTGGGCAGCTTACCGTGGACACACGGAG
          CTGGTGCGACTGCTGCTGGACAAAGGAGCCGATGGCAATGCCCATGGTAACTACCACCTGGGCGCCCTTTTGTGGGCGGC
          GGGCCGTGGCTACAAGGACATCGTGGAGCTGCTGGTGCAACGCGGCGCTAAAGTGAATGTGGGTGATAAGTACGGAACCA
          CAGCCCTGGTGTGGGCATGCCGGCGCGGAAACGTTGAGATTGTGGATACCTTACTTAAGGCTGGAGCCAATGTGGACACC
          GCTGGCATGTATTCGTGGACGCCACTGCTCGTTGCGGCCGCCGGTGGCCACACAGATTGCGTTAGTTCCATTCTCGAGAA
          GAAACCAAATGTAAATGCCTTGGACAAGGATGGAATGACTGCCCTTTGCATAGCGAGTCGAGAGGGTTTCCAGGATATTG
          CCGCCTCCCTTATTGCGGCTGGTGCCTACATAAATATCCAGGATCGCGGAGCAGACACGCCGCTCATCCATGCCGTTAAA
          GCAGGACATCGAACTGTAGTGGAGGCTTTGCTCAAAAAACATGCCGATGTGGATATACAGGGAAAGGATCGCAAGACGGC
          CATTTACACCGCGGTGGAGAAAGGACATACGCCGATTGTTAAACTCCTGTTGGCCACCAATCCCGACCTCGAATCCGCCA
          CCAAGGATGGCGACACTCCGCTGCTGAGAGCTGTTAGAAACCGCAACTTGGAGATTGTGCACTTATTGCTAGATCGAAAG
          GCCAAGGTGACCGCTAGCGACAAAAGGGGCGACACCTGCCTGCACATCGCAATGCGGGCGAGGAGCAAGACGATTGTGGA
          GGCCCTTCTGCGAAATCCCAAGCACAGTCAGCTTCTATATAGAGCCAACAAAGCTGGAGAAACGCCCTACAACATTGACT
          CCCTGCACCAGAAGACCATATTGGGTCAAGTGTTTGGCGCCAGACGTCTGAACACCAACGAGGACTCCGAGGGAATGCTG
          GGCTACGAACTGTACTCCTCTGCCTTGGCGGATGTGCTCAGTGAGCCGACATTAACCACTCCCATTACCGTTGGACTCTA
          CGCCAAATGGGGCAGTGGAAAGAGTTTCCTGCTAAATAAGCTGCGCGACGAGATGAACAACTTTGCGCGCCAATGGGCGG
          AACCACCGATTCGAACCAGTGGTCTGCTCTTCATCGTCTGTCTTCATGTGGCATTGCTCATTGGAACTATTGTGGGACTG
          AGCACTTGGTCAGCGGTTGTGGGCGTGTCGGCGGCCGTCGGCTTCTTGCTGCTCGCCTATCTGCTCCTGGCAGCTGTTAG
          ATACTGTAATTACCAAATGGACATGCAGTGGGCCTACTCTGTGCAACACGGTCTGGAGAAGAGAATGACAAGATTGCGTT
          TGATACTTCAGGTGGCCTTTTGCCATCCCCCGGGACCCCAATCGGATTCACAGGCAAAGCCCGTTCGGTTTCACTTTGCG
          GAGGCCAACAGCGCTTCGCCCACAGGTGATGGAGCAGTGGCTCATATGCTGGCCGCTCTCTTAGATGCTATAGAATCTCA
          CTACGGTTGGCTGGCCACGCGATTGTACCGAGCCTTCCGTCCAAAGTGCTTAAAAGTGGATGTTGGCTGGCGTTGGCGTC
          GCATGTGCTGTATCCCAATCGTTTTGATCTTCGAACTTGCTCTCGTCACCGTGGTTACTGGCATCTCTCTCACCGTGGCC
          TACTTCACGTTTGCCGATGAGAAGGAAAAGGAACATATATTAGTGGCTCTCTATGTAATTGCTGCCGTGATGGGCACGCT
          GATCTGTACGCATCTCCATGTTCTGGCCAAGGTGTTTGTATCCCTGTTCACCTCCCACATTCGAGTACTAAAAAGGGCAG
          TTCGGTCCAGTGAGTCGGCTCCATTGACTATGCTGGGTGCCGAGGTGGCCGTGATGACGGACATGGTCAAGTGCCTGGAC
          GCGTTCACCAATCAGCAGAGCCGCTTAGTTGGCGTGATCGATGCCTTGGATTCCTGCGACACGGAGAGGATTCTCACCCT
          TCTAAATGCGGTGCAAACGCTTCTTTCTTCACCTAACCGACCATTTGTCTTGCTCATTTCTGTGGATCCCCATGTCATAG
          CCAAAGCAGCGGAGGCTAATAGTCGACGACTCTTTACGGAGGGCGGAATCGGAGGACATGACTTCCTGAGAAACTTGGTG
          CATCTGCCTGTTTATCTGCAAAACTCCGGACTGAGAAAGGTGCAACGAGCCCAGATGACAGCGCTGCTGTTCAAGCGAAG
          TGGCGGAGGAGATTACCAGACAGACGATGGACCCACATTGGGTCACTCTGTATCCGCTCGTCGACTGTCCAATGCCTCTG
          AAATAATCTCCAGTCAGGAGAAGCTGCGCGGACCCGCCCGTGGAGGTGGTGGAAAGAAGCTGCGTCTCTCCGAATCCGTG
          GCCAGCTCAACTGGTTCCAATCTCCATCGCCTGGGTCAGAATCCCCAGACCGTGCTCGATCTATCGCGCATTGTGCTCAC
          GGATGATTACTTCAGCGATGTGAATCCACGAAGTATGCGTCGCCTAATGAACGTGATCTACATCACGGTGCGCTTGCTCA
          AGGCCTTCCAGATTGAGTTCAGCTGGTATCGCCTGAGTTCGTGGATCAATCTGACTGAGCAGTGGCCTTTGAGAGCAAGT
          ATGATAGTGCTGCATCACGATCAGTTCATGGACAGCAATGCGGATGAGAGTGTATCGCTGCAAAGCGTTTACGAGAAATT
          GCGACCCAAACTCGCTTACTTGCGAGAAGCTGCTCCACTTCTAGAGTTGGATAGGGATGAACGAAAGCTCGACGCCTTCC
          TGCAGCTGCACAAATCAGATTTACTCGTGGCGGATCTCCGCATCTTCTTGCCCTTCACCATTAATCTGGATCCCTACTTA
          AGAAAGGTCTTAAAGGAGGATCAGCAAACCATCGAGGACGAGGGCTCCCTAGTGATACAAGCAAGGCCCAGCGTTTCCAA
          TACAATGCGTCAATTCCCAGCGCCCACCACTTACGTGCCTTCGCCGCAGGCTTATCCACCCTACCAAATGTTCCAGAACG
          AGTATCCTGCCAATGAGTTGCGCTCCAGGAATCTCAGCACGAGCACAGAGCCTGTCACCCCGCTCATTAACTCACCTAGT
          GATTCGTTTGGTGATGATATCCTGCAAACCAAGCTGACCGATTTGACCGTTGAGGGAGTCATCAGCCTGCTGGATCGGAT
          TGAGGACATGAAGCCAGCGTTGCCCAAACTAGCGCCCGTGCTCCGCGAGAATGCAATCAATGGACGTGTGCTGAAGCACT
          GCGATATGCCGGATCTGAAATCGGTTCTGGGCCTGAGCTTTGGCCACTGGGAGCTGTTCCGCCTGCTGATCACCACGTTG
          CGGGAATGCGAGCGATTGCCACGGAAGCAACAGCGTCAGCAGCAGCAGCCGGGTGCGTTGGAGGCACCATCGAATGTCCC
          GATGATTAAGGATGTGACGGATGCCCTGATGCAGCCACCCAGAGAGTCCCTCTCGCGAAAGAACTCCGTCAGTCATATGG
          AAAAGCAGGTCACGCTGGAGGAGCAGATGATCTGCGGCACCTTGCAGACTCTGAATGAGGAGGCGTACGAGGATGTGGCC
          AGTAGCGAGCGACCGAGTCCCACAGAACTCGACACACCGAGTGCCGGAGCAGCAATGACGACCCCATTGCTCGGTGCCTC
          CGGCTCTGTGCCAGCGCCGTCAGGTCGGGAATCTATTTTAAAGCAGCAGGGAAGCGTCAAAGCAGACAAGCGAGTATCGA
          TTCAACAAATGGCGACCAGCAACAACAACAACAATAATAGTACCAAGCTAACGCCAAATGTGGAGTATGTTTCCGAACGC
          CAGCCGGAAGTCCAAGGTGCCGGCAAACGCTTGACAACCAAGCCGCCACCAGGACCTCGACCCGCCTCGCTGATCATCAC
          CAGAAACGATTCCAACTCACAGTTCCAGCTGCTGCGCTCCTCCTCAGTGGACTACGACGACGTGGAGGCCCAGGAACACC
          GGACCACGATAAGGACCACCTTGCTGGAACAGCAGGAGGAAGAGGAATCAGCCCCTTTCGTCTTTACAGTGCGAAAATGA
          CACAATCTTCTCTACTAGGTGAAACCAGCCAATGAGATGGCCATTTAGTGCCAGCTACGCTTAGTTACAAATTAGTTATA
          ACGCAATTAGCTAATAACTGGAGGACTTTGTGGAAACTCTGCCTTTTGGGTGACACAATGATGTAGTTGTATAGTCGATA
          CGCTAAGAAAAGACACTTTGTTTGCAAGTCCTGGTTGTAAGTCACAGAAAACACAACTTGTTATAAATGTATAATGCATG
          TGCATCCTTATATTATATAAAGAAAATG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0302701
          5291
          FBtr0302703
          5356
          FBtr0302704
          5071
          FBtr0342885
          5321
          FBtr0342886
          5273
          FBtr0302702
          5454
          FBtr0302707
          5193
          FBtr0344188
          5989
          FBtr0344189
          5826
          FBtr0479847
          4825
          FBtr0479848
          4988
          FBtr0479849
          5088
          FBtr0479850
          5251
          FBtr0479851
          5303
          FBtr0479852
          5436
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0291846
          1500
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0291841
          1478
          FBpp0291843
          1550
          FBpp0291844
          1498
          FBpp0309686
          1488
          FBpp0309687
          1518
          FBpp0291842
          1476
          FBpp0291847
          1552
          FBpp0310600
          1640
          FBpp0310601
          1642
          FBpp0428183
          1518
          FBpp0428184
          1516
          FBpp0428185
          1493
          FBpp0428186
          1491
          FBpp0428187
          1528
          FBpp0428188
          1516
          Comments

          Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG42672-RJ
          Secondary FlyBase IDs
            References (0)