Open Close
General Information
Symbol
Dmel\Osi5-RB
Species
D. melanogaster
Annotation Symbol
CG15590-RB
FlyBase ID
FBtr0302937
Feature type
Associated gene
Evidence Rank
Length (nt)
889
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            ACTGAAGGCACATTTCTTTCTTTCCAGAAGCAGCATTGTTTTAATTTACAATTGTGACAATTCGGCCGGGGACGCTTGAC
            TGACTTCGCCTCCTCCGTTTTCCCCCTGGGAAAGTGCGCCGTGGAAATGCGAGCTATAAAAAATGACCGGGCAATTGTCA
            AGGCTTTTAGTTGAACTTCAAGCGTTTTGGCAACATGTTCCGCACTTTTCCTCTGCTCTGTTTGCTGTTCCTTACGGCTG
            TCCGTTCCGAAAACTGTGATCAGGATGCCGGTGCCACGCTATATTGTCGCGGTGAACGAGCTCTGCGAAATGTCTTGCGG
            AATTTAAATCGCAGTGATAAACCCCTTGTGGTGATTAGAGGATTGGAGATAGTTCCGCTGCAGAACAATTCAATTTCTGA
            TGAGGAGCCGGATCAGGAGCAGGGTCTTTTGGACAGTCTATCCTTCTATCTGCGCACCCACGAAATCAATGTAAAGCTGG
            CAGATCTCCTGGAGGACGAGTCCCAAGTTTCAGCCCGCAAAAAGGACAAGGGCCAGGGAATGCTGTTGGCAATGGCTCTG
            ATGTTTGGCAAGATGATGGCCGTAATGGGGTTGGGCGGCATCGCGGCATTGGCCATGAAGGCACTGGGCGTGTCCTTGGT
            GGCTCTGATGATGGCCGGGATGCTGGGTCTTAAGACAGCCGCCCAGCATGGCGGAGAGTCTAGTCACAGCATATCGTATG
            TGACCGGCGAGGGACATCACCACAAACGGAGGCGCCGCTCGTCCGGCCAACAACCCTTGGCTTACAGAGGCTGGGACTGA
            GGCACTGAGGGGCCCATGATGTTATCGTGCATTTTGTTAGTTCTCATGTAGCACTTAAATAATTTAATAATTTATCCATC
            ATGCAACAG
            
            Other Products of this Gene
            Other Transcripts
            Name
            FlyBase ID
            Length (nt)
            FBtr0078595
            892
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0292063
            201
            Derived from OTHER transcripts
            Name
            FlyBase ID
            Length (aa)
            FBpp0078244
            202
            Comments

            Transcript terminates at site supported by polyadenylated cDNA.

            5' UTR based on RNA-Seq and/or EST data.

            External Crossreferences and Linkouts ( 1 )
            Crossreferences
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (1)
            Reported As
            Symbol Synonym
            Osi5-RB
            Secondary FlyBase IDs
              References (0)