Open Close
General Information
Symbol
Dmel\CG7991-RC
Species
D. melanogaster
Annotation Symbol
CG7991-RC
FlyBase ID
FBtr0303103
Feature type
Associated gene
Evidence Rank
Length (nt)
4073
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 3 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GCGGCTCAGTCTGCAGCCGCCGTCCGTTGGTTTCGGTTGCTGTGCGCCTTGTCGAGCGGAAGTGTCCGAGAGTCGCCGGC
          GAAAGCGGGCCAGAAAGCCCAGCTTCTATTGCCATACAGCTATATAGCCATATAGAAGTCCGATCTCGAAGCCCGAAGCA
          GACCGTTGAACCTCCGAACGAAGGAGTAGCGTAGCGCACCACGCGACAAAAAGGCGCCAGCCAGAGTAAACTAAAGGTGG
          CAGCCAAGCCACATAGCAGAAACGTGCAACAAATAAACACAGAACCTAACGCATTTGTATTTTTTACCGCAAGAGCTCAT
          GTGTGTGCGCGTGTGTGTGTTAGGGCGGAAGTTGTTCCAGCGCCATTGTTGAAAACCCCCCCAAAAGGAAAGGCAAGGAA
          AACAAACCGTGGCCGGAAACCGGAAGTGTGTTATTAGTGGCGCCTCACATTTATTTACTCGAATTGAAATGCACTCCAAA
          CTTTGTGAAGTTGCTGCAAAGTGAAGTGAAGTAACAAAGGCCCGAGAAAATCATATTAATTAAAATTTATGCCAAAGTTT
          CGGTAATTTGCGTGTGTGTGCGTGCCAGTGTCCGTGTTTGTGTGTTTGTGCTCTGTGTCTGTGTGCCAAAGTTTTAATTG
          AAGAAAACTTATCGCCGCATAAATGTTCGTTGCGCTATGCTAATTGAAATATAACGCAACTGTTGCAAGAGAAGAGCGAA
          AGAGGACGCGGATTACAAAGGGATAAAGGAATAAAAGAATTAAAGGACGAGAAAGGACTTGACAAGCCACAGACTGTTGA
          GGAAGGTGCGATTCAGGAGCGTCGTTTTTTTGGCATCCTCCGTTCGGCGAAAAGGAAGGACGCTGCCACATCGTTACCAA
          CCTATCGTCACAATGGCGACAACGTGTCTATCACCACTGCCCCACCTGCGGATAGACTGCCTCTGGGTTACGAGGGAGCT
          GGAACTATAGAGCTGCAGGCTCAGGAGAACGACTACGTGCTTGAGGAGTCCGCCCTACGAGTCCCACTCTCCCCGCCGCC
          GAACTACTCTCCGCATCCTTTGACCCCACCGCCCAGTTACACGGAGAGACCAAGATCAGTCCAGGAACACAGATCGCACT
          TGGCCGAGGCACTGCATCCAGCTGCCCCCGCACGTGTAGTGATATTTCCCCCAGTAGGCGCAAATACAGCAGCTAGCGAA
          CAGGCAGCACGTCAACAAGCCAGAAGGAGACGGCGACTCCGGGAGCTTCAGCAGCAGCAGCTGCGATTCGCCTCCAGCAC
          CGATAGCTCCAGTAGCTCCGGATCCAGTTGCTCCGAATTAGGGAGCGACAGTGCTAGCAGAAGGCAGCGTCGACGCAGGC
          GGGGATTAAGGGATGCCTATTGTCCAGATCTTCTGAACGCGTGCTCCCTGATCCTCCAGAACCCCGGCAGCAGTGACAGT
          TCCGTGGGTAACTTCACGGCCACGCCCCCGCCTCCGGTGCGAGCACCTGGTCACCGGGATCAGGAGGAGAGCTTCGAGTA
          CAGCTCCGACTATGTGGAGATCGACGAGCTGCTGCCACTAGTCGCCGGCGGGAGAGCGAAGAGCACTCCGCAGCTGGCGA
          TGGGTCAAAACCTGAGCCTGCGACGGCCGCGCATCTCATTGACCTGGGTGCTCCGAGAGCAGCAGCAGACGCAGCAGGCT
          CCTCCGTCGCAAACACCCCCATCCCCGCAGAAGGAGGCAGCGAAGGAATCGGACAGCCAGGTGCTGGATCGCAAGGAGAA
          CGAAGTCTTCCCGCCCAGAACAGAGCCCGTGCCCACCCAGCTGGATGTCACCAAGAAGCGGTACCGTGTTAAGCAGCTAC
          CAAGTGGTGGTGAGCCGCTCAATGGCTATGCCACCACGCCCACCGCCCACCAGGCTCCTCCCAACGGTCACCTGGCCAAC
          CAGAAGTTCTTCAGCAACCAAAACCTGCTGGACGTGTCACGGAGCGGTCCCAGCAGTGCTCCAGTGGCCGCCGCCTCCAC
          CAAAGAGCTGCTCTTCGTGTGCACACCCCAGCGGGCGCCCAGGACCGATAGTCATAGCGAAGCCCTGCTTCTGGCCAGAA
          AGCGAAACGAGATCCGTAAGAAGCTGGCCTCCCGCCTGCAGCAGGCAAGATCCAGTGCCTCGCAGGCGGGTGAGGCCAGG
          GGATCGGTCACGGGAGCGGAGTCTGTAAAGTGCACCTCCTACTCGGAGCCCAGTTTGGTGGCTGCCTCGGAGGGCGGCGG
          AGTGGGGGGCTCGGGCGGAGGAGCAGCTGCCCCCCAGCAGCAGCGGAGACATAGGCATCGCAAGCGTCGGGATCGCAATC
          GTGTGCAGAGATTTGGCTATGAGATCCACAACGTGGACGAGTTTCTCTCCCGCTGCTCTCTGGCCACTCCCGGCAATATT
          CCCGTGGTTCTTTCCACGGCCAGCACCCTATACCAAACGAGACCAGGTGGCTACCAACTGGAGATCCCTCTGCCCCTGGG
          CATGGTGGTGAATGCGGTTTTCAAGAACCAGAACTGGCTGTATGTGCAAACGCCCCACGCGGAGGAGGGCTATGTGGGCT
          ATGCCTGCTGCCTGCCCCTTGGGATTCTGCCCCAGCAGGCAAGAGCGGGCTCCAGGAACACCCCCTGCTGGGAGTCCAAT
          GCGGATGTCTTCCCCCGCCCATGTGGCAACATGACGGACTCGGAGAAGGAGATCCGCCTGCGTGGTGGCACCCGATCCGA
          TGGCGCCCGCACTCCACGCAGCTCAAAGCCCACTGAAGATGTCCTCAAGATCGGATCCACCACCATCAACAACAACAACA
          ACCATAGCAATAATAATAACCAAGCGAAGTGCGGGAGCACAACCAGCTCCTTGTACGGAGAACAACAGGTGGACAAGCTG
          TATCTGAGGGCCGCATCCAAGCCGCGCCTAGTGGAGAAGGCGTACGCCCAGTTGCGCTCCACTCGCCAGGTGACTGCATC
          TGGTTCAGCTTCGGCCAAGAGCGGCGCTTCTCAGGATGAGTATGTGACCCTGCAGCCAAAGCCCGCCAAGAAGCAGCCGA
          GTGCCCAAGCCCATTTGCACCAGTCACAGCCAGCGGCCAGGCGCCTCTCCAACGTGTCCTACATCACCAACGGCCACAAT
          GGCCAGCATCTGCATCCGAAGCTCGTGCCCCTGCCACCCTACGAGCACAAGCCGGCCAAGAACCAGGCGGAGGCAGACGC
          CACCCTAAAGGCGCTGCGGCGCCAGCAGGAGGTGGGCCAGCGACAAACTCTAGTCGCCATCAACACGGACTACATCACGG
          AGAGCATCGCGGTGCACAAGGGTGAGATTGTCACGCTGTGCGAGTGCCGCGAGTCCAAGGATCAGCGCCAGTGGTTCTAC
          GTGCGGACGAGGGACGGACGCGAAGGCTTCATTCCGGCCGAGGTGGCCGGCCATGGCTACCTGTAGACCTCCACCTTCTG
          GTATTGGTATGGGTCTCTAAGGGTCATATGAAAGGGATTAGAAAGCTTAATGTTAACTATGGACATCCTTTGTCATATTA
          ACCAACCATCATATAATTGCTATATCTAGAATATCTTAATCTTTAAGATTTTCTCATGATTTTGTGGTAAATTACTTAGC
          TTTATATTTCGACTCTTTCCATTACTGAGTAAAGTATCATTCATGAAAAAATGGAGCCCAACCACCGTAAGTTGTCCAAA
          GAGCACCTTCTCCCTTTTAAGATTTCCAAAAGGACCCACCCCAAAAACAAGTCAAGTTCTACATTTAAATGAATTAACTT
          AATACCCATCTTAAGCACTCATAGGCCACTAATTCCATTCGCGATCCTTAGTACGCTTCTAGTTGTAAACTGTATTCATA
          TCGGTGTCCGTAATTGAATTGAATTGTATCTGTATCTGTGTATGTTTATGTGCGTGAGTGTGGATCCTTCGCAGGATCTT
          GTATTTATCTAGCCTAGCATTACGAGTACTCTATGTAATAGAAAACTTGCTTAAATGAAATCAAAGACGAAAGCGAAGAC
          GGAACCTATTTATATAATAACTGTACTTGATGCTTCTAATAAATAACAGACATTTAAATAAATATAAAAAACC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0303102
          3727
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0292222
          608
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0292221
          888
          Comments

          Transcript structure supported by RNAseq data.

          Transcript terminates at site supported by polyadenylated cDNA.

          Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG7991-RC
          Secondary FlyBase IDs
            References (0)