Open Close
General Information
Symbol
Dmel\Rap1-RB
Species
D. melanogaster
Annotation Symbol
CG1956-RB
FlyBase ID
FBtr0303154
Feature type
Associated gene
Evidence Rank
Length (nt)
2872
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 85 )
Sequence
GTGCCATCGATGCTTTGGCAGCCCTAGTCTTTGAGTGTTCGCTGTTCGCTGAGGGCGAAAAAGTAAAGAAATTACAAGGC
AAACTAGTGTTAAATTAAAAGTGAAGCGATTCGCGAGCGGCGACAGGTGAAGCGGTCCCCAAGGAGCAAGCAGTTGGCGG
CAGCGAGTGAAAAGCATAGGTAAAACTCCGCCCAGAGTTGCCCTGCCGCCCGACATGCGGGTGCATTTGCGTGGTTCAGT
TGTTTAGTGGCCGTTCGGTAGGCCGATGTACGCACATGGGTGCCCAGTGTGCAATTTAAGTGCATTTTAATGTGCTCTCG
GTAGCAGTGACGGCCGTCTCGAGGAACAGTCAAGCCAGGATATTTCCGCTCAAAAAAGCAACAATTGAACGCACGCAACT
CGGCGGAAGGAGCGAGCGAGAGAGGGAGCACAAACACCATCACACATTCACACACACTAACACACACACACTCACGCAGT
CACTTACACGGCACAAAGGTTATCAACAGCAAAAGCAACAACAACAAACAATTTACTTTAAATATAAAACATATATTAAC
TAATAAGCAAGAGCAACAAAAAAAAACAAAAACAAAAAACAACTGCAACCGACAAGCAATCGCCGAACAACGCCTAAAAA
CAAGTGATTTTCGAGGGAGAGCCACCTGGAAAGTGAACCCACCTACCTGGCCTACCTGCATTTTGGGTCTCTTCCCTAGA
ATTTAGCACAAAACAAGAGATATACGAAGGATATACAAACAGCACAGCAGCCAGCATGCGTGAGTACAAAATCGTGGTCC
TTGGAAGCGGCGGCGTGGGCAAATCCGCGCTGACAGTCCAGTTTGTCCAGTGCATCTTCGTGGAGAAGTACGATCCCACC
ATCGAGGACAGTTACAGGAAGCAGGTGGAGGTGGACGGACAGCAGTGCATGCTGGAGATCCTGGACACGGCGGGTACGGA
GCAGTTCACGGCCATGCGGGATTTGTACATGAAGAACGGCCAGGGATTCGTGCTGGTCTACTCGATCACGGCGCAATCGA
CGTTTAACGATCTGCAGGACCTGCGCGAGCAGATACTCCGGGTGAAGGACACGGACGATGTGCCCATGGTGCTCGTGGGC
AACAAGTGCGACCTCGAAGAGGAGCGCGTCGTCGGCAAGGAGCTGGGCAAGAACCTGGCCACCCAGTTCAACTGCGCCTT
CATGGAGACCTCAGCCAAAGCCAAAGTGAATGTGAACGATATTTTCTACGACCTGGTCCGGCAGATCAACAAGAAGTCGC
CCGAGAAGAAACAGAAGAAGCCGAAAAAGTCCCTATGTGTTCTGCTATAAGACTTCCAAAAACCACCAAAACTAAAAAAA
CAAAAAAAAAAATATATAACAGAGGAGGAGGAGAGAGGAGCAAAAGTATAAGCGTAAAGTAAAGAATTTTCAAATTTTTT
TCGTTCTCGTTTCGTTTTGGATCCGATGGCAATTGTCGAATTGAAATAACCAATCTACTATATACAAGCAAAACTTAAAC
TGACAAATGTTTTTAACTGTTTCAAGTTTTTGTAATTATTACCATTTACTACTATTATGATTGTACTATTTTTCGCTGAT
TAACCATTAATTCATATGGGGAATTATTATATATATATATCTACATATTTAAATATATTTGTCGTTCGTTTTTGAGCCGT
TTTTTAAATTATGCAACAAGTGAAACATTCGTAAACTAAAACATTCGTATTTATTGATTCTTTTCGATTGTACTCTACAC
ATCTACAACTACAACTACTTATACACGCGAAAGCCCAACCAACAACAAGTATATCTTTAAATAGAACCGAAAACAACATT
CGAAACACAAATCAAATTAAGCTAAACTAAATTGTACGCCTAAAAGATAAAGATAACAAATTCCACGAGAGAAATGAGCA
AATAAATCGAGAAAGGAAATGAATCATGAATAAGGAACATATTTTATAAAAATATTGTATGCAAATGATGTCAAAATGTT
GCAAACAACCAGAAGTAATGAGCCCCCTCCCCCTTAGAAATTAGTTTAAAACAAATTTACAATTAATTGTTTACCACGAT
CAGTTGCATCAAATCTGAACCCCCCCCCCCAAACACACACATACCAGCCACATCCCACACACACACACACACATTCGCAA
CCAGAACTCACACACACAAACACACCTACACATTTCCGGCGCGCTCTCAGAGAGCGAAAAAGCTACACGAAAACGGAAGC
GGAATCGAGACAAGAGGCTCCTGCGGCCAAGGCTCATTTCCGCTTCCTGGTAAAAAGAAGAGGAGCAGGAAGTGCAGAGA
GAGCCACAAATTCTAGAATATTTAATACATAAGAAATGGTTTAACACAAACTAAACTGTCGTGTCAATCCCAAAATGAAA
AGAAACCTAAAAACGAAGTAATTTACAAATATTTCATAATAAACATTGCATAAACTTCGCGTACGAGTAGTAACCAATAT
GCCCTTAAATCAAAGTCTAAACACAGCCAACAACCAACATTAAAAGTAAACTAAATAAAACCTAAGCCCAAGCGTATATA
TTAAATATATGATAAAGATACAAATCATTTTTGAACATAATAAACAACAAACAAACCAACCGTTACAATAACATAATGTA
ATAATGAGCGTGTGAAAAATGTAATTGAAAAACCATTTTTTCGAACTTGTTTCCCTACTGGTCGCGTTTTTGGGACCCCA
CACAGAGCCTCTGATCTCAGAATCCTGGCAGTCCCGAATTCGCGACGCAGTAGGTCGACATGATCGAGCATCTTTTAATT
ATTAATAAATGTATTATGTTTATAAAAAATTAAAAAGGAAATGCAAAAACAAAATAAAAATTAAATAAATTC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0072867
2741
FBtr0332671
2702
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0292253
184
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0072746
184
FBpp0304917
184
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
R-RB
Rap1-RB
Secondary FlyBase IDs
    References (0)