Open Close
General Information
Symbol
Dmel\Srpk79D-RE
Species
D. melanogaster
Annotation Symbol
CG11489-RE
FlyBase ID
FBtr0303599
Feature type
Associated gene
Evidence Rank
Length (nt)
3919
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CTGTCTTTCAGTTTTTATTTAGTTATTTACGAAGCCACTAAATTACGATCCTGTAAAGTAGAAGATTTTCCGCCGTGCGA
          TATATTTTATTTATTTACCCCGCTCGGGCCACTGTTATGTAAGGAGAGTGTGTGCAGCGTGGTGTTTGTGTTCGACCAAA
          CTCGTTCGGCGGTGTCCGTGATGCAAGTGGGGGTCTACGAAAGTCAAGGTCGCCACCCCCTACACGCACGCCCACAGCCA
          TCCCCTGTTACTGCGCCCAGTTGCCATGAATTCGCGAAGGTCTAATCGGAAATCCAATTGTCGAATCGAGCAGTGAATCG
          AATCAGAAATGGATGACTTTGGCTCGACCGCATCCGACTTGGAAGAGGCCACCTGCCCCATGCAGGCCAATGCCACGTTC
          AGCATCGATTGGCGAGTGACCCTGCTGGACCACTGGTTGGATCTCTATCTTGGCTACATGAACCGCCTACACATGCTGCT
          ATCACTAGCCGGCAGGCTGCATCTTCTAAGCCGGCACATCCTGGGTACTCTCGGCCAGGATCCGATTTTTATGGGTGTGC
          TGCAGGGCAGCCTGTTAATGCTCTTCCTCTTCCTGATGCACCTGCTGCGGCTGTGGAGCTGTGGATACGCAGTTGAGCGG
          CCGCTGAACCCCACTCCGGACGTGGCAAAAGAGCTGAGCTGCGACTTCAACTTCGTCTCCGAGCAAGAGAAGCGAGCTGC
          CCAAGAAGCCGCGACGGAGGCTCTGCTAGAGGTTGAGGAGAAGAAGCGCCGCAAGCGGTTTACAAAGAAGCGCAACTGCG
          TGTCCGCCGGGCCGATCCTTATTGCCTTGCGCCATCAGTCTAAGCGACCAAAGCACCATCGTCACGCTGCTCTACCCTTT
          GAGCCCGTTACCCCCGGGGAAATAATCCTGGATACCTACTTGCCGCCGCGGGAACTGCCGCTCACGATAAGACTGCCTCA
          GTTGGCGGAGCCGGTCAAGGAAGAGGAAGTCGAATATATCGAGCTTAAATCGGAGCCCCGGGGGACCCTCAGTACGACCG
          ACGAAATTTACCCGGATTCGTCCGACAGCAGTCTTTACGTTTCAGACGAGGAGCAGGAAGACGCCTCTCAGTATTGCCGC
          GGTGGATACCATCCAGTAGTCATCGGAGACATATTTGACAACCGGTTTCGAGTGGTCAGAAAACTGGGCTGGGGCCATTT
          TTCCACTGTCTGGCTATGCCGGGATCTCAAAGATGAGAAGTACGTGGCCCTCAAGGTTGTTAAGAGTGCTCCGCATTACA
          TAGAGACGGCAGCGGACGAGATCCGGCTCCTGGAAGCTATCCGTGACGCAGACCCCATGGACGTTAAGCGGGAGAGGATC
          GTGCGGCTGATGAACCACTTCACTGTGCGCGGTGTGAATGGAATGCACACCTGCCTGGTTTTCGAGGCCCTGGGCTGCAG
          CTTGTATAAGCTGATAGTGAAGAACAACTACCAGGGTCTGGCCATCGCTCAGGTGCGTAACATAATCCGCCAGGTTTTGG
          AGGGACTGGACTACCTGCACAGCAAGTGTAGCATCATACACACGGACATTAAGCCGGAGAACATCCTGCTGGTGATCGAT
          AATGCCGCCGCGATGAACCAGCAGATCGACGATGAGATCAACAGTCTGCGCGTGAAGGGTGTCGACTTCCCCGACTCGTA
          CATCAGCTCCATCGAGAAGCAGACCAAGTCGCGGGCCAAGTGGCCACTGATCGAGCCAAATGGATCGACCAACACCAACA
          CTAACACTAGCAATAGCACGGCGACCAATTCCAATTCGTCGACTCCGCTGGCCGCCGTGATCATGTCCACGCTGGACAAG
          GAGGACACCACGACAACCACCTCGTCCACGCTCAATTCCAACACCACATCATCGCTGGCCTCCAAGTACTCCAGTCTGTT
          GGGGGACAGCGAGTGCAACGGAGGCCTCGGCGGATCAGCGAACATAAACAACCGCTACCGAACGGAGAAGAAAATCACTG
          CCAAGTCTTCTGGGGATTGCGACGAAGATGCCGAGTCCGACACGCTGGGCGAGCAGAGCACCTTGGCGAGCACCATGGAT
          TCGCCCACCGATCTCGATCCCGAACCCGAACTCGATTCCAAGCCCAACACCGTACCCGAGCCAAGTGAAGGACCGATCCC
          AGAGAACCAGAGTCAGAGTAGCCAGAACAACACCTACACGATCCAGTCGCTCATTGACAACAGCAACGTTCGGGTAAAGA
          TCGCCGACTTGGGGAACGCCTGCTACGACTACCATCACTTTACTGAGGACATTCAGACTCGCCAGTATCGATCAATCGAG
          GTTCTTTTGGGAGCGCCGTACAATTATACCGCCGACATCTGGAGCACAGCCTGTTTGGCCTTCGAGCTGGCCACCGGCGA
          CTACCTGTTCGACCCTCACGCCGGAGAGTCTTACAGTCGGGACGAGGACCACTTGGCGCATATTGTGGAGCTGCTGGGCT
          CCATACCGCAGTCGGTGATCTTCCGCGGTAAGCACGGGCTGAAGTACTTCACCAGCTATGGTAGCCTGAGGAACATCACC
          AAGCTGAAGCCCTGGAGTCTAATGAACGTGCTGGTGGAGAAGTACGACTGGGACCCGGTGGAGGCCAAGAAGTTCTCCGA
          CTTTCTGCTGCCCATGCTTGAGTACAATCCGGTTATACGGGCGTCGGCAGCGGAGTGCCTGCAGCATCCGTGGTTGGAGC
          AGGAGGAGTTCGTCTAAGAGGCTCATGGAGTGACTAGACAGCCAGAGAGACACAGGCATAGGCACAGCTTAACTTTTATA
          TGCAAACAATTTGCCATAAAGAGGAGGTAGCAGGAAAATGGGATGAGGAGCTAGCATTAAAGGACTCGATCGAAGCACAC
          ACATTTTACACTTACGAAATGCGGACGATGTGGGGGCGTTCCGCGTCGAATTTTTTAAGCTTTTTAATTTTTGTACTTGA
          GAGCTTTAAAATGTAATTACTAAAGAAGCGATTTTACTTTTAACGACAAAAGCAAACGAGAGAAGTAGCGCAAATGTTTT
          TCAAGTTTTATTTCGACGACGTGCATATAAGTATATACATACATATACACATATATTTTTTATTAACTGAGAAACAAAAA
          CAAAAGACAATGACGACAATTTTTAGTCAACAGATGCCTAAACTGACTGACTGAAAAGGAATACATTTTCATGCGAAACC
          AAGTAAAACCAAATCAGTGAGAAATGCTAAATAGATTGTACGAACTAGCAAAATATTCAGCATCACATAAATAACAATAC
          CTTCTATAATATTAATAAGCAAGTATGTGTATAATTAACGAAACCCCATTGTAGATATCGAGAATGTTCACAAATACAGA
          TGTAAACTCAAATATTGACAGCTTTTTAGCAGAGTGTAGTGATTTTGGTACATTTAACCGAACCCATTTGTAGATGTTTA
          GGCCTATGTTGATTACGAGCAGATTTGAAAAGATGCCCTACTTACCCGATTTCGGTTTGCAAAACTTATCATTTAACCAT
          CCGTGAAAAAGAACCTATCCCAGATCATGTAATTCAAAAAGAATTAAAAACAATAATAAATCATTGCATAAAAGTCTTTG
          TATCGGAATTGAAAACTCAAAATCGAAATTTAAATACTACCAATGATAACTACTGAGAAATCATATTACAAAATAACGAA
          AACATATTTTACTACTTGCCTACAAGTATTTGTACACAAGCCTACAAAGTAACATTGAACGTGACCAAATAATTTAATAT
          TGCGGAAGATTTTTCCCCCAAACTCATATTTAATATACACACACGTGTGCGCATGTGTCCAAATGAAATTTAACAGAAAT
          TGAAGCGGAGGAGCTGCACGTTCGCGGGAGTGGACACATATTTCAATAAGCCGAAATAAAGAATATACATACCGATCCG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078496
          3760
          FBtr0303600
          4365
          FBtr0304724
          4206
          FBtr0306594
          3359
          FBtr0306595
          4706
          FBtr0306596
          3900
          FBtr0306597
          3518
          FBtr0334748
          4765
          FBtr0334749
          3930
          FBtr0334750
          3771
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0292632
          802
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078148
          749
          FBpp0292633
          869
          FBpp0293266
          816
          FBpp0297549
          898
          FBpp0297550
          965
          FBpp0297551
          1018
          FBpp0297552
          951
          FBpp0306789
          950
          FBpp0306790
          802
          FBpp0306791
          749
          Comments

          Transcript supported by FBrf0208928.

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          Srpk79D-RE
          srpk79D-RE
          Secondary FlyBase IDs
            References (0)