Open Close
General Information
Symbol
Dmel\chinmo-RF
Species
D. melanogaster
Annotation Symbol
CG31666-RF
FlyBase ID
FBtr0303934
Feature type
Associated gene
Evidence Rank
Length (nt)
5037
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 24 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ACGCGCTGTATTTTATTTTAGTTGACTTCATGTGTGCATTGTCGTTCTGTGAGTGCGCGAATCCAACTAGAGTTCCGCTT
      CGTCTCTGCCAAGTAGCGAAGAAGTTTTGCAGTTGTACATTCGAAAAACAAGCAGGTAAATACTTTCATCCTCCTGGTAA
      AATACCCACCCTCAGTGAGCGGTAACTATGATCAGCCAAGCGTTTTCCCAGTGGGCTCAAAGTTATCGTGTCTCATTTGG
      CGTGTTCGGAGTCGGATTCAGTTTTGAGATTCGGTGCTCTCACAGTCTCTGGTTAAGTTTCTATGCCAACGCCGACACAA
      AACTTATCAGCTACGATTAAAGCAGCGGAAGTGATTAGAGAACCGGAACGATTCGCACCGAAATCGGCGACGCACAAGAA
      ATTAACTAAACAATTGCAAAATTCCCTTTGGCTAAGGATTTGCAGCGGCCGTATTGCTTTTATGCTCTGCTGGCAGCTAC
      AAAATTCCACGAAATTCCATTTTGGCAAACCGAAGACAAACAAATCAATTTGCAGAGCCGCTGAAAAACAGCAGCAGCAT
      CAGCAGCATCAGCAGCCCCATTACCAAAATTCGAAAATAATTGGAAAATATCGAAAGCAGCGTCGTCGTTGTCGCCGTTC
      TGGCGCCCTTCGAACAGCTTGGATCCTGAGAGCTAAGGACACCGATACGGACAGAGATACGGACAAAGATACGGCCACGG
      ATCGGGACAAGGCTATAGCATCACTGCTGGCACCATGGATCCGCAGCAGCAGTTCTGCCTCAAATGGAACAGTTTCTCGT
      CTAACTTGGCAATAACATTCTCCAATCTGTTCAAATCGGATCTACTGGCCGATGTCATATTATCCTGCGATGGCGTAGTA
      TTCAAAGCCCACAAACTTATATTGGCGGCCTGCTCAAAGAAGTTCGCCGATCTGTTTGAGAACACGCCCACAAATGGCCA
      GTGCGTCATCATACTGGAGGCGACCACGCCGGACAACATGGCCGCTCTGCTGGAGTTCATGTACAAAGGCGAGGTCCACG
      TCTCCCAGGAGGCGCTCAACAGTTTCCTCAAGTCCGCCGAGAGTTTGCAGGTCAAAGGTCTGTCCACGGAAACGGGACGT
      CTGGCGGCACAGCAGGCACAACAACACATGGGCGACCTGTCGCCACTTGACTCGCCGACGGGCAGGCGGAGCGTAAGGAA
      CAGCCTGAGCGGCGGTAGCAGCAGCATCGTTCCCGGCGGAGTCGGAATCGGTCTGGGAGGAGGCGCAACGGGAGCCAACT
      CTATGTCCGGCATGGGCATTGGCAACGGGTTGAGCTTGGCCGGTATGGCAGCTGGCGGAGGAATGGCGGCGGCTGCAAAT
      GCGGCGGCCAGTAGCCTGAGCACCCTAGCGGCCAGCGCGAATATCGTTGACAGATGCGGCAGTGCTGGCGCCAACATAAT
      CAGCGGATCGGCTGCAGGGATTGGCGGCTCCCATAGCGGGGGAGCGGGTAATGGCAGCGGCACAGTTGGAATCGGTGGCA
      ACGGAGTCGGCAGTGGTGGCGGCAACAATGGACCCATTAGCCTGGGAAGCGGCGCGGGCGCTGCTCACCATCTGGGCGGA
      TCCACTGGCATCTTGAAGCAGGAATGCGACTCCCTGATGCATCCGGGTGGCAGTAGTTCCTCTTCCGGAATGGGCTACAC
      CCATGTGCCGCCCATCTACCGGCCTATTAACTACGAACCTCCGCGCAAGAGGGCTATAGTCCGCAGTCCGTATTCCGAGC
      AGGAACAGCGCGGTTCCGTCCTGCGAGATGGCTCCAAGTCCTCCGAGTGTCCCAGCCCCATCAACAAGCCGCCGTACCAC
      CGTCCCTCGTCCAGCGCCTCCTCCACGGCGCCCACCGAGGCCGACACCATGCACTCCGAACGCGCATCGCCACAGTCCAG
      TCGCTACGAGAACCATAGTCCCAGCACCACAGCGGGAAATGGAAATGCCACCAGTAGCCTGGAGCGCATTGTGAAATCGG
      AGCGAAACAATGGCAGTGCCAATGAGGCTAATGACGACGACCGCGAGCTTATGGATGAGTCTACAGATAACGGAGCCGAG
      GATCTGCGCGTGAAGCTGGAGAACTTGAAGTACTCACCGCCACCGCCGCCAAACTCGAACACCTCGTCGACCACACCGAA
      TACGCTGCTGGAGAACCTGAAGGCGGACGGAACGCTGTCCAGTAACCTGGCCGCGTCGATTGCGCCGGCGGACATGTTGA
      ACGTATGGAACGCCACCAAGATGAACAACAAGAACAGCGTGAACACGGCCGACGGTAAGAAGCTGAAGTGTCTCTACTGC
      GATCGTCTGTACGGATACGAGACGAATCTGCGGGCGCATATCCGGCAGCGTCATCAGGGCATCCGAGTGCCATGTCCCTT
      CTGCGAGCGGACCTTCACGCGAAACAACACGGTGCGCCGTCACATTGCCAGGGAGCACAAGCAGGAAATCGGATTGGCGG
      CGGGTGCAACAATTGCTCCAGCACACTTGGCAGCGGCAGCTGCAGCATCAGCAGCGGCTACAGCGGCAGCCAGCAATCAT
      TCACCATAGGAAGCAGCCGCAACAGCAGCGGCATCAGTAGTCATGAACGCCAACAAGGAGGCGGCAAAGCAGCGCAAACG
      TAAAACACTCAAGATGGCACTGGAGAAGTGCATGCAGCGACGGGACGCAATGGTGGCGGAGACCACCACGGGGGCAGGAG
      GAGATGGGGCAGAGGCAGGAGGGGAGTCGGGCGAGGCAGTCGACGGGGCAGGATCGGAAGAGGGAGCCGGTTCAGAGGGC
      ACTGAACCGCTCACCTACGAGCAGCAGCAGCAGCGAATGCACCAGGAGCTGACGCAGCAGATCAGGGCGGCCATGGCGGC
      GGAACAGGCCGCCGAGGCGATGGATTCGACCATGAACACCACGGTCAACACCACCACGACGACCACAACCACAACGAACA
      CCACTGGCGCCACCAGTGATGGTTGCAGTGACGCGGAGGCCAGCGATGGTAGCGATCGACCCATGGAAGTGGACGAGGAC
      CAGCCACCGGAGCCACAGCCAGGATCTGAGCTCGTTGTAGTGGAGCCCAAGATCGAGGTGCTTTCGGAGTCCGAGGACGA
      GGAGGATCGACTGCACATGTCCGAAGCCGAACCGGATATCCAGGCCGAGGCCATTTACGATCACATGCCCAACACGCCCA
      CCAGCCCCCCACATATAATACCGCCCAACGATACGCCCACTCTGACCTCCACGCCCAAGGTCAATGTGGAGCAATAGGAT
      GAGGAGAAACGAGGAGATGCCCCCAGAGGATGCCCCCCAAAGAAGCTGCTTAGATTTAGGCTAAGAATCGATGAAACGAC
      GGAGTGAAAGATAGACGAGTGATTTACGCGCGCGCAAAGAAGATGAAACATGACTACTGATGCAACTGCTGTTGCCCTCG
      GAGACCACCTACGACCAAGCTGGACAAGAAGCCCCAAACTGGGCACATTGATTACTATGATAACTAAACAAGGAAACAAG
      GAACCTAATGATAAGATGTACCACACACGTGCACGTGTGCACACCAAACACACAGCAAACAGACGGACAGACAAGCGAAC
      ACACGAAAAACAGATGGCGAATTTGATGACCACCAACTTTTTGCAGGCATTTTTATTACGAATTTGTGTTTTTGAAGCCA
      ATCACAATTCAAGCAGCAGGCACAAGCAAGAGCAACAAATCCAAACCAAACCAAACCAAACCAATTAATGGCAGTATGAA
      ACAGGACACTCAACCAGAAACCAGAAACAGAACCAGAAATATAGAATTAAATGCAATCCGGCTGAAAAATCGTTTTCAGG
      GTGCTAATCAAACAATGAAAAACAAGTGAAACTTACGAAACTAACGAAATAGTAATGCAAAAAGTTTGAACGTTTTTGAT
      TGGTACCGCCCAAAAAGAGAGAGAGTAGCCAGCATATAGCAAAAACAAAACGTTGAGAATTTGTTTATTCGTGTGTGTTG
      AGGGAGTAGATCGATGATTAGATTATTGTCGCATATATTTTTGATTTCCTATAGAAACGTCACAGAACTGCAAGTTGCCT
      CAGATCAAAACGAAACGACAATGCTAAGCCTAAAAACTGAATTAAATAAGACGCGAGTAACTATAATTAAACACTGCAAA
      CACATAGCAACAAACAAACTACAGAGCAACAATAGCAACAACAAAACCGCAACCACAAGTACCTGCAACAATAAAATAGT
      ATAAAAACAAAAGAAACAAAATACAGAATAGAAAAAGAGAAACGCTGAACCTAAAGAACCTAGGGAGGAGCCAGAATCCG
      AGGATCCTTGAGTGCACCACATGGACCATGGATGTGGTTTCCACTTACCCGAAAGTCTGCCCCTTTGTCCGGTTTTTTTG
      TACATAATTTTATTAAATTAATAATACGAAAAGGCAAACGGGGCCAGGAGTGTAGGGCCAAGTGAGGAGACCACTGCTCC
      ACGGCCACCAGGATTCCAGGATTCCAGGATCTGTGCTCGAGGACAGACGAGTTTTGCTTTAAGGATGTAACATTTTGCTT
      TGTGATTTTCGTATTGTTTTATGATTTCCCTTCCAGTTTAGGCCTCAAAATTTTATACAACTGCTTTTCGGCTACAAAAT
      CTAAAACAACAAATTCAATTCCGAATTCAGAAGTTTCTAACGAAGTAAAAACAATTGGTAAATTGGGTGCCTATAAGAAA
      TATATAATTAAATGACTACTAGTAAAATTTTATAAACAATGAAGAGTATATTTAACGATGAGCGAGAAAAGCAAATAGCA
      AAGAAAACGTAAAGTAAATATAATTATTTTTTAATTGAATAATTCTAGCCAAGTGTGAAACATGTTAATTAACAAACGCA
      AATATTACGCAAAAACCACTCAAAAACGTTCTCAAAAACTTGATGGCAACAACAAAGGCAACAAACAGCAATAATTACAG
      CAACCAAACGAAATTCAAAATCAAACTTTTGGCACACCTTTGGAAAACATTTTTCTTCGTACAAATGAAAATTCACC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0077878
      4159
      FBtr0077877
      6019
      FBtr0303933
      6320
      FBtr0303935
      6089
      FBtr0307047
      12385
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0292933
      840
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0077546
      604
      FBpp0077545
      604
      FBpp0292932
      840
      FBpp0292934
      604
      FBpp0297890
      604
      Comments

      Stop-codon suppression (UAG) postulated; reflected in aa sequence of predicted polypeptide.

      Transcript terminates at site supported by polyadenylated cDNA.

      translation_exception: stop_codon_readthrough

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      chinmo-RF
      Secondary FlyBase IDs
        References (0)