Open Close
General Information
Symbol
Dmel\chinmo-RG
Species
D. melanogaster
Annotation Symbol
CG31666-RG
FlyBase ID
FBtr0303935
Feature type
Associated gene
Evidence Rank
Length (nt)
6089
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 34 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCAGTCAAAAAGAAACTGCCGTGTTGAACGGACGTGTTGAAGTTTCGCGGTTGCTTGTTTCGGTGGTGCTCGCAGCAGCA
        GCAGCGTTTGTGCATTCGCATTCGCAGTCGCAAATTCGCATCGCCTCGTCGCTCGTCAGCCCTGGCAACTGCAGGCAACT
        CAAGTTTTACACCCAAATGTCAATGTGAAAATGTCTCAACGAGCAAATTTTAGGAAAGTCAAGAAAAACATTCAACGACC
        TCAAAACCAGCGAATGCTACAAAATGCGAATCAAGAACATTTAACCATCTAAATATTCAAAATCAATTTAATTGAATCAA
        ATAACGCGAAATTGCAACAAATCAACCTAAAAATGAACTGAAAACAAAAACATTTCGAAAAACAACGCAAAATTCTAAAA
        TTGGCAACATAAGTTTTGGTCTTGAATTAAATACAACAAAAATAAATTAACAAAAAACGATTTTTGGCAACAAAACATCA
        TACATAAAATATACACAAATTGTAATTATCTCAAAACGTCCACACGTGAAAATGATTTGCAACTAAGATGACAATCTAAT
        AAAATCAATGTAAATTTTTAACGCAACAAAAGGAAAACCAAAACCGTCAGCAAAAACCAGCCCAAAATCAGTTGAAAAGC
        CGAGGGAAATCTTTTTAGAACAAACGCAGAAAACCGCAAAAATTTAAGCCACCAAATTGGTAAACTATTCAAAATTATTG
        GTTCGGACATACGCAATACTAAACACAGCAACACAACAACAACAACAACAACAGCAACAACAGCAGCCATAGCAACTACT
        ACAGTGATCACTACAGTAAAAGCAACCGCAACAGAAGCAGCAGATAAAACGTGTGTGTTAGTTTGCATAAAAATTTCGTT
        TCGATAAAAGCAAAGCAAAATCATTTAACAAAATAAATAAAGAATAAAGTAAAAAAAAAAATTACCAATCGTAATACATG
        TATTTATAAAATATATACCTATACATATATCTATGCTTACGAATTATATCGGAGAATATTTGGTAAACAATTTTTGATAA
        AAACAACTCGAGTATATATCCTAACTAATTAGCAACAAAAAGAACTAGAACATTTGGCCTAAGTGAAAAAAAAAGTGAAG
        TGAGAAAAACTAAAAAGAAAAACTTATAAATTCAAAATTACCACTTGTGAAAGGTGTTACAACTGAGGATTCTGGATTTG
        GATTAATGCGTAAATTTGCAATTGAATATTAAGGTAACTATGATCAGCCAAGCGTTTTCCCAGTGGGCTCAAAGTTATCG
        TGTCTCATTTGGCGTGTTCGGAGTCGGATTCAGTTTTGAGATTCGGTGCTCTCACAGTCTCTGGTTAAGTTTCTATGCCA
        ACGCCGACACAAAACTTATCAGCTACGATTAAAGCAGCGGAAGTGATTAGAGAACCGGAACGATTCGCACCGAAATCGGC
        GACGCACAAGAAATTAACTAAACAATTGCAAAATTCCCTTTGGCTAAGGATTTGCAGCGGCCGTATTGCTTTTATGCTCT
        GCTGGCAGCTACAAAATTCCACGAAATTCCATTTTGGCAAACCGAAGACAAACAAATCAATTTGCAGAGCCGCTGAAAAA
        CAGCAGCAGCATCAGCAGCATCAGCAGCCCCATTACCAAAATTCGAAAATAATTGGAAAATATCGAAAGCAGCGTCGTCG
        TTGTCGCCGTTCTGGCGCCCTTCGAACAGCTTGGATCCTGAGAGCTAAGGACACCGATACGGACAGAGATACGGACAAAG
        ATACGGCCACGGATCGGGACAAGGCTATAGCATCACTGCTGGCACCATGGATCCGCAGCAGCAGTTCTGCCTCAAATGGA
        ACAGTTTCTCGTCTAACTTGGCAATAACATTCTCCAATCTGTTCAAATCGGATCTACTGGCCGATGTCATATTATCCTGC
        GATGGCGTAGTATTCAAAGCCCACAAACTTATATTGGCGGCCTGCTCAAAGAAGTTCGCCGATCTGTTTGAGAACACGCC
        CACAAATGGCCAGTGCGTCATCATACTGGAGGCGACCACGCCGGACAACATGGCCGCTCTGCTGGAGTTCATGTACAAAG
        GCGAGGTCCACGTCTCCCAGGAGGCGCTCAACAGTTTCCTCAAGTCCGCCGAGAGTTTGCAGGTCAAAGGTCTGTCCACG
        GAAACGGGACGTCTGGCGGCACAGCAGGCACAACAACACATGGGCGACCTGTCGCCACTTGACTCGCCGACGGGCAGGCG
        GAGCGTAAGGAACAGCCTGAGCGGCGGTAGCAGCAGCATCGTTCCCGGCGGAGTCGGAATCGGTCTGGGAGGAGGCGCAA
        CGGGAGCCAACTCTATGTCCGGCATGGGCATTGGCAACGGGTTGAGCTTGGCCGGTATGGCAGCTGGCGGAGGAATGGCG
        GCGGCTGCAAATGCGGCGGCCAGTAGCCTGAGCACCCTAGCGGCCAGCGCGAATATCGTTGACAGATGCGGCAGTGCTGG
        CGCCAACATAATCAGCGGATCGGCTGCAGGGATTGGCGGCTCCCATAGCGGGGGAGCGGGTAATGGCAGCGGCACAGTTG
        GAATCGGTGGCAACGGAGTCGGCAGTGGTGGCGGCAACAATGGACCCATTAGCCTGGGAAGCGGCGCGGGCGCTGCTCAC
        CATCTGGGCGGATCCACTGGCATCTTGAAGCAGGAATGCGACTCCCTGATGCATCCGGGTGGCAGTAGTTCCTCTTCCGG
        AATGGGCTACACCCATGTGCCGCCCATCTACCGGCCTATTAACTACGAACCTCCGCGCAAGAGGGCTATAGTCCGCAGTC
        CGTATTCCGAGCAGGAACAGCGCGGTTCCGTCCTGCGAGATGGCTCCAAGTCCTCCGAGTGTCCCAGCCCCATCAACAAG
        CCGCCGTACCACCGTCCCTCGTCCAGCGCCTCCTCCACGGCGCCCACCGAGGCCGACACCATGCACTCCGAACGCGCATC
        GCCACAGTCCAGTCGCTACGAGAACCATAGTCCCAGCACCACAGCGGGAAATGGAAATGCCACCAGTAGCCTGGAGCGCA
        TTGTGAAATCGGAGCGAAACAATGGCAGTGCCAATGAGGCTAATGACGACGACCGCGAGCTTATGGATGAGTCTACAGAT
        AACGGAGCCGAGGATCTGCGCGTGAAGCTGGAGAACTTGAAGTACTCACCGCCACCGCCGCCAAACTCGAACACCTCGTC
        GACCACACCGAATACGCTGCTGGAGAACCTGAAGGCGGACGGAACGCTGTCCAGTAACCTGGCCGCGTCGATTGCGCCGG
        CGGACATGTTGAACGTATGGAACGCCACCAAGATGAACAACAAGAACAGCGTGAACACGGCCGACGGTAAGAAGCTGAAG
        TGTCTCTACTGCGATCGTCTGTACGGATACGAGACGAATCTGCGGGCGCATATCCGGCAGCGTCATCAGGGCATCCGAGT
        GCCATGTCCCTTCTGCGAGCGGACCTTCACGCGAAACAACACGGTGCGCCGTCACATTGCCAGGGAGCACAAGCAGGAAA
        TCGGATTGGCGGCGGGTGCAACAATTGCTCCAGCACACTTGGCAGCGGCAGCTGCAGCATCAGCAGCGGCTACAGCGGCA
        GCCAGCAATCATTCACCATAGGAAGCAGCCGCAACAGCAGCGGCATCAGTAGTCATGAACGCCAACAAGGAGGCGGCAAA
        GCAGCGCAAACGTAAAACACTCAAGATGGCACTGGAGAAGTGCATGCAGCGACGGGACGCAATGGTGGCGGAGACCACCA
        CGGGGGCAGGAGGAGATGGGGCAGAGGCAGGAGGGGAGTCGGGCGAGGCAGTCGACGGGGCAGGATCGGAAGAGGGAGCC
        GGTTCAGAGGGCACTGAACCGCTCACCTACGAGCAGCAGCAGCAGCGAATGCACCAGGAGCTGACGCAGCAGATCAGGGC
        GGCCATGGCGGCGGAACAGGCCGCCGAGGCGATGGATTCGACCATGAACACCACGGTCAACACCACCACGACGACCACAA
        CCACAACGAACACCACTGGCGCCACCAGTGATGGTTGCAGTGACGCGGAGGCCAGCGATGGTAGCGATCGACCCATGGAA
        GTGGACGAGGACCAGCCACCGGAGCCACAGCCAGGATCTGAGCTCGTTGTAGTGGAGCCCAAGATCGAGGTGCTTTCGGA
        GTCCGAGGACGAGGAGGATCGACTGCACATGTCCGAAGCCGAACCGGATATCCAGGCCGAGGCCATTTACGATCACATGC
        CCAACACGCCCACCAGCCCCCCACATATAATACCGCCCAACGATACGCCCACTCTGACCTCCACGCCCAAGGTCAATGTG
        GAGCAATAGGATGAGGAGAAACGAGGAGATGCCCCCAGAGGATGCCCCCCAAAGAAGCTGCTTAGATTTAGGCTAAGAAT
        CGATGAAACGACGGAGTGAAAGATAGACGAGTGATTTACGCGCGCGCAAAGAAGATGAAACATGACTACTGATGCAACTG
        CTGTTGCCCTCGGAGACCACCTACGACCAAGCTGGACAAGAAGCCCCAAACTGGGCACATTGATTACTATGATAACTAAA
        CAAGGAAACAAGGAACCTAATGATAAGATGTACCACACACGTGCACGTGTGCACACCAAACACACAGCAAACAGACGGAC
        AGACAAGCGAACACACGAAAAACAGATGGCGAATTTGATGACCACCAACTTTTTGCAGGCATTTTTATTACGAATTTGTG
        TTTTTGAAGCCAATCACAATTCAAGCAGCAGGCACAAGCAAGAGCAACAAATCCAAACCAAACCAAACCAAACCAATTAA
        TGGCAGTATGAAACAGGACACTCAACCAGAAACCAGAAACAGAACCAGAAATATAGAATTAAATGCAATCCGGCTGAAAA
        ATCGTTTTCAGGGTGCTAATCAAACAATGAAAAACAAGTGAAACTTACGAAACTAACGAAATAGTAATGCAAAAAGTTTG
        AACGTTTTTGATTGGTACCGCCCAAAAAGAGAGAGAGTAGCCAGCATATAGCAAAAACAAAACGTTGAGAATTTGTTTAT
        TCGTGTGTGTTGAGGGAGTAGATCGATGATTAGATTATTGTCGCATATATTTTTGATTTCCTATAGAAACGTCACAGAAC
        TGCAAGTTGCCTCAGATCAAAACGAAACGACAATGCTAAGCCTAAAAACTGAATTAAATAAGACGCGAGTAACTATAATT
        AAACACTGCAAACACATAGCAACAAACAAACTACAGAGCAACAATAGCAACAACAAAACCGCAACCACAAGTACCTGCAA
        CAATAAAATAGTATAAAAACAAAAGAAACAAAATACAGAATAGAAAAAGAGAAACGCTGAACCTAAAGAACCTAGGGAGG
        AGCCAGAATCCGAGGATCCTTGAGTGCACCACATGGACCATGGATGTGGTTTCCACTTACCCGAAAGTCTGCCCCTTTGT
        CCGGTTTTTTTGTACATAATTTTATTAAATTAATAATACGAAAAGGCAAACGGGGCCAGGAGTGTAGGGCCAAGTGAGGA
        GACCACTGCTCCACGGCCACCAGGATTCCAGGATTCCAGGATCTGTGCTCGAGGACAGACGAGTTTTGCTTTAAGGATGT
        AACATTTTGCTTTGTGATTTTCGTATTGTTTTATGATTTCCCTTCCAGTTTAGGCCTCAAAATTTTATACAACTGCTTTT
        CGGCTACAAAATCTAAAACAACAAATTCAATTCCGAATTCAGAAGTTTCTAACGAAGTAAAAACAATTGGTAAATTGGGT
        GCCTATAAGAAATATATAATTAAATGACTACTAGTAAAATTTTATAAACAATGAAGAGTATATTTAACGATGAGCGAGAA
        AAGCAAATAGCAAAGAAAACGTAAAGTAAATATAATTATTTTTTAATTGAATAATTCTAGCCAAGTGTGAAACATGTTAA
        TTAACAAACGCAAATATTACGCAAAAACCACTCAAAAACGTTCTCAAAAACTTGATGGCAACAACAAAGGCAACAAACAG
        CAATAATTACAGCAACCAAACGAAATTCAAAATCAAACTTTTGGCACACCTTTGGAAAACATTTTTCTTCGTACAAATGA
        AAATTCACC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0077878
        4159
        FBtr0077877
        6019
        FBtr0303933
        6320
        FBtr0303934
        5037
        FBtr0307047
        12385
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0292934
        604
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0077546
        604
        FBpp0077545
        604
        FBpp0292932
        840
        FBpp0292933
        840
        FBpp0297890
        604
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        chinmo-RG
        Secondary FlyBase IDs
          References (0)