Open Close
General Information
Symbol
Dmel\Sik3-RA
Species
D. melanogaster
Annotation Symbol
CG42856-RA
FlyBase ID
FBtr0304024
Feature type
Associated gene
Evidence Rank
Length (nt)
2983
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AGTGTGTTTTGTATTTGACCAGCTTTTACGGTGACAAAAAGTGCAAAATCGAAATGTGAAAAGTAATTTGCGTTCGAACA
      AAGAGCCATTAAATCGAGACTTGAAGGCGTCGTAAACCAAAAAAATATATATACATATATTGAGAACAAATAAAACGTTC
      GAGGAAGTGTCGCTTCAATAAATAAAAAAAAAAAAACTAAAGAACAAAGTGAGCATTGGAGTTGCCTGGTGGGCATGGCC
      CACTGCCCGCCGAGAATCCGCTGGAAAGTCCGAACGAGAAGCTGCCATTGACCTCTTAATCGAGTTAAGTGAATATTTTA
      GAGTCCGCGCAAACTCTACACAACTCACACAATCCACTGTTGCTGGCGGCGGCTCCCCCGTCTCCAAACTCCCGGATCCC
      CAACCAGTTTCCCGCATCCCGTCATCCCAATTCTCCGTTCTCCATTCTCAATTCTCCGGTTCACCATTCTCCGGTTTGTT
      AGTCTCGCCGCCAGCAAATGAACTCTCGCGTTCGCGTTTGAACTGCGCGACAAAAGAAAATGCATATTAAGTGAATTTCC
      TGTGCGCGAAAAGCCAATTACGCATCCGCAAGAATCCTCATCCTCCTACGGCAAAAAGAGAAAAAGGGAATACACCGACG
      CAGCTGCGACGATGGCCACCACACCAACGGCTGGGCCAGCAGCAGCTCCTCCAACGTCCTCAACGCCGCAGAACTACAAG
      GTGCCATCGACCAGCAAGATATCCGTGGACAAGCTCCTCCGGGTCGGCTACTATGAGCTGGAGAAGACCATCGGCAAGGG
      CAACTTTGCAGTGGTCAAGCTGGCTACCAACATTGTGACCAAGACAAAGGTGGCCATCAAGATCATAGACAAAACATGTC
      TGAACGAGGAGTACCTGAACAAGACGTTCCGCGAGATAGCGATCCTTAAATCGCTGCGGCATCCACACATCACGCGATTG
      TACGAGGTGATGGAGTCGCAGTCGATGATCTATCTGGTCACCGAGTACGCGCCAAACGGGGAGATCTTCGACCATCTGGT
      GGCCAATGGCAGGATGAAGGAGCCGGAGGCGGCACGTGTCTTCACCCAACTCGTCTCGGCCGTTCACTACTGCCACCGGC
      GCGGGGTGGTGCATCGCGATCTCAAGGCCGAGAATGTCCTTCTCGACAAGGACATGAACATCAAGCTTGCCGACTTTGGC
      TTTAGTAATCACTATGAAGAGGGTGCCACCTTAAAAACTTGGTGTGGATCACCGCCCTATGCCGCTCCAGAGGTTTTCCA
      AGGCTTGGAATACGATGGACCCAAGTCGGATATCTGGAGTTTGGGCGTTGTGCTGTACGCCTTGGTTTGTGGAGCATTAC
      CTTTCGATGGAAAGACTATCCTGGAACTGAAAAGTCGCGTGGTGTTGGGCAAATTTCGCATTCCCTTCTTTATGTCGCAA
      GAATGCGAGCAGCTAATACGGAACATGCTGGTGGTGGAGCCTGATCGGCGATACACTATCAAACAAATCATCAAGCACCG
      CTGGCTCAGCGAGTGGCAGTCAGAGATGCAGGAGCAGGAACGTTTCGGTGACATGTCCCCCGGCTCGGGAACAGTGTCCA
      AATCGGCGTCCACATCCTCGCTGGGAAGTGCGTCGGATTCACCGCCGCAACTGGACTCTGTGGTAATGACGCATATGCTC
      CAATTGCCCGGACTGACCGCCGACATGATAGCACAGTCGGTGCACGAGCAGAGATTCGACAACATCTACGCCATTTACAA
      CCTGCTGCATGACAAGCTGCAGCAAAGGCGACGCGAAAACCAAAGACTGCAGCACCACGCCAGCCTAGCCTACTCCCGAT
      CACGTAAGACGAGCATCACGACGGGCGTGGTGGATCGCTCGGAGCCCGTCAAGCAGGAATCTCTGGACCGACTCAGTCCG
      TTGAGCAATGCCAATGCCTCCAGCTCAGCTTTGGGCTTTGGCTGGTCCGATGTCGCCGTGGATCTGGAGAAATATGGTGA
      TTTTGAGCTGGAATGCCTGGCGCGATCAAATGATCCCCCTGTTAATGCGCAGCATTTGAGTGCACACGCTGGTGGAGGTG
      TCAATGGTGCGAATACCAGACGCCATACAGTGGGACCCGGCGATGTGGCCCACGAGCAGGCGCTGGCTAATCCCAATGTG
      CCGCCCATCGACTTCAAGTGTCCACCGCAGTGCAGCGATCCCACTCAGCCAGTTCCCTACTATCCAGTTAATCTGCCCAT
      GCTGCAGAACCAACCCCTGCACAACCTCACCATCAAGGATCAGCATTTGCTCAAGCCGCCCGTTGTTATGGGAGCCAGCT
      CATTTGGGCGTCGTGCCTCAGACGGCGGGGCAAATCTTCACATCTACTATCCCGCCACGGGCACCGTTGTGGGTCCAGCT
      CAGGGTCAGCAAATGGACACGGCCGGGTACTATATCAATCCGAATTGCGGCACAGATCCTTTGGCAGTGCAGGAGCTGTC
      GCCGCTCAACGAACAGTCGGTGGCGCAGATGCAATGCTGCCAGGAGAATGCCACCGGCGAATGCAACGAGGAGCTGCAAA
      GCTATATGCAAAAGCGTGGAGGCACCCAGCGCCATACGGTGGGCTGCACGGAGGATCTATCCGTAGCACATGGATCAGGA
      GCAGGATCACAGTCCCAGGCGCCAACTACCTCCTCCAATATGCGGCAGCGGCGAACAGGATTGCTCACGGTCACCGAGAG
      ACCGCCAGGTGCGTTAGAGAGGCTAACTAAAATATTATAAAATATGCAATATCGAATCATTCTGAATATGTGGAATATAG
      GATGCCATTTTAATAGGAAAATTAAGATTATAATTTAAATTTGGCTTAAAAATTTAAACTGCATGCTGCTCTATATATAG
      CCTTAAATCAGAGATATAGTGTATTATTAAGTGTTTATATAAGATATGTGCTCACATGTTCATTTTGTACACATGTATTT
      AATTATAATTTGATTACTGTATT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0304025
      5637
      FBtr0304026
      6469
      FBtr0340388
      6278
      FBtr0344258
      6020
      FBtr0344259
      6011
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0292993
      702
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0292994
      1471
      FBpp0292995
      1471
      FBpp0309334
      1468
      FBpp0310663
      1382
      FBpp0310664
      1379
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG42856-RA
      Sik3-RA
      Secondary FlyBase IDs
      • FBtr0086604
      References (0)