Open Close
General Information
Symbol
Dmel\Sik3-RC
Species
D. melanogaster
Annotation Symbol
CG42856-RC
FlyBase ID
FBtr0304026
Feature type
Associated gene
Evidence Rank
Length (nt)
6469
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 21 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GAGTCGGTGCCGAGTTTTTGCTTCGCGAGCAGGTGGTGTTGTCCAATCAGAATCGCCGTAGACGGCACGAATAACAGAAA
        AAAATTCCAATAGAACAGCCGAGGGCGATTATTTATGTGTGTTCATGTTAAATGTTAAATGCAAAATTACGCGTCGCACG
        CTGCGCCCACGCGATTTCGAATCCGCATCCGATTGTTCAGTGCAAACACACACACACCAACCAAGTGAATATAATATGTA
        AGCGAAAGGCAAGAAGCCAGCAACAAAGCGCCAGTGATAAGCGCAATAATATAAATGCAATATAGTATAAATTCAACGTG
        AAAAGAAATCTCGCCAGCGAAATACAAAAAAAAGCGGAGGAAGCGACAAATGGAAATCAAGTAAAATGAAGAAGAGCGGA
        GAGATAGAAATCGTAATGTACGGTGACAAAAAGTGCAAAATCGAAATGTGAAAAGTAATTTGCGTTCGAACAAAGAGCCA
        TTAAATCGAGACTTGAAGGCGTCGTAAACCAAAAAAATATATATACATATATTGAGAACAAATAAAACGTTCGAGGAAGT
        GTCGCTTCAATAAATAAAAAAAAAAAAACTAAAGAACAAAGTGAGCATTGGAGTTGCCTGGTGGGCATGGCCCACTGCCC
        GCCGAGAATCCGCTGGAAAGTCCGAACGAGAAGCTGCCATTGACCTCTTAATCGAGTTAAGTGAATATTTTAGAGTCCGC
        GCAAACTCTACACAACTCACACAATCCACTGTTGCTGGCGGCGGCTCCCCCGTCTCCAAACTCCCGGATCCCCAACCAGT
        TTCCCGCATCCCGTCATCCCAATTCTCCGTTCTCCATTCTCAATTCTCCGGTTCACCATTCTCCGGTTTGTTAGTCTCGC
        CGCCAGCAAATGAACTCTCGCGTTCGCGTTTGAACTGCGCGACAAAAGAAAATGCATATTAAGTGAATTTCCTGTGCGCG
        AAAAGCCAATTACGCATCCGCAAGAATCCTCATCCTCCTACGGCAAAAAGAGAAAAAGGGAATACACCGACGCAGCTGCG
        ACGATGGCCACCACACCAACGGCTGGGCCAGCAGCAGCTCCTCCAACGTCCTCAACGCCGCAGAACTACAAGGTGCCATC
        GACCAGCAAGATATCCGTGGACAAGCTCCTCCGGGTCGGCTACTATGAGCTGGAGAAGACCATCGGCAAGGGCAACTTTG
        CAGTGGTCAAGCTGGCTACCAACATTGTGACCAAGACAAAGGTGGCCATCAAGATCATAGACAAAACATGTCTGAACGAG
        GAGTACCTGAACAAGACGTTCCGCGAGATAGCGATCCTTAAATCGCTGCGGCATCCACACATCACGCGATTGTACGAGGT
        GATGGAGTCGCAGTCGATGATCTATCTGGTCACCGAGTACGCGCCAAACGGGGAGATCTTCGACCATCTGGTGGCCAATG
        GCAGGATGAAGGAGCCGGAGGCGGCACGTGTCTTCACCCAACTCGTCTCGGCCGTTCACTACTGCCACCGGCGCGGGGTG
        GTGCATCGCGATCTCAAGGCCGAGAATGTCCTTCTCGACAAGGACATGAACATCAAGCTTGCCGACTTTGGCTTTAGTAA
        TCACTATGAAGAGGGTGCCACCTTAAAAACTTGGTGTGGATCACCGCCCTATGCCGCTCCAGAGGTTTTCCAAGGCTTGG
        AATACGATGGACCCAAGTCGGATATCTGGAGTTTGGGCGTTGTGCTGTACGCCTTGGTTTGTGGAGCATTACCTTTCGAT
        GGAAAGACTATCCTGGAACTGAAAAGTCGCGTGGTGTTGGGCAAATTTCGCATTCCCTTCTTTATGTCGCAAGAATGCGA
        GCAGCTAATACGGAACATGCTGGTGGTGGAGCCTGATCGGCGATACACTATCAAACAAATCATCAAGCACCGCTGGCTCA
        GCGAGTGGCAGTCAGAGATGCAGGAGCAGGAACGTTTCGGTGACATGTCCCCCGGCTCGGGAACAGTGTCCAAATCGGCG
        TCCACATCCTCGCTGGGAAGTGCGTCGGATTCACCGCCGCAACTGGACTCTGTGGTAATGACGCATATGCTCCAATTGCC
        CGGACTGACCGCCGACATGATAGCACAGTCGGTGCACGAGCAGAGATTCGACAACATCTACGCCATTTACAACCTGCTGC
        ATGACAAGCTGCAGCAAAGGCGACGCGAAAACCAAAGACTGCAGCACCACGCCAGCCTAGCCTACTCCCGATCACGTAAG
        ACGAGCATCACGACGGGCGTGGTGGATCGCTCGGAGCCCGTCAAGCAGGAATCTCTGGACCGACTCAGTCCGTTGAGCAA
        TGCCAATGCCTCCAGCTCAGCTTTGGGCTTTGGCTGGTCCGATGTCGCCGTGGATCTGGAGAAATATGGTGATTTTGAGC
        TGGAATGCCTGGCGCGATCAAATGATCCCCCTGTTAATGCGCAGCATTTGAGTGCACACGCTGGTGGAGGTGTCAATGGT
        GCGAATACCAGACGCCATACAGTGGGACCCGGCGATGTGGCCCACGAGCAGGCGCTGGCTAATCCCAATGTGCCGCCCAT
        CGACTTCAAGTGTCCACCGCAGTGCAGCGATCCCACTCAGCCAGTTCCCTACTATCCAGTTAATCTGCCCATGCTGCAGA
        ACCAACCCCTGCACAACCTCACCATCAAGGATCAGCATTTGCTCAAGCCGCCCGTTGTTATGGGAGCCAGCTCATTTGGG
        CGTCGTGCCTCAGACGGCGGGGCAAATCTTCACATCTACTATCCCGCCACGGGCACCGTTGTGGGTCCAGCTCAGGGTCA
        GCAAATGGACACGGCCGGGTACTATATCAATCCGAATTGCGGCACAGATCCTTTGGCAGTGCAGGAGCTGTCGCCGCTCA
        ACGAACAGTCGGTGGCGCAGATGCAATGCTGCCAGGAGAATGCCACCGGCGAATGCAACGAGGAGCTGCAAAGCTATATG
        CAAAAGCGTGGAGGCACCCAGCGCCATACGGTGGGCTGCACGGAGGATCTATCCGTAGCACATGGATCAGGAGCAGGATC
        ACAGTCCCAGGCGCCAACTACCTCCTCCAATATGCGGCAGCGGCGAACAGGATTGCTCACGGTCACCGAGAGACCGCCAG
        TGATTCCACCCGAGATAATTCGCGAGGTTGAGTCTCGCATGAAACGTGACTATCTACCTCCCACCCTGAAATCTCTCAGT
        CAATCGCCCCCCAATGGCACCTACCCGGTGGGCGCGGCTCTGCCCATGGGTATGTCCAAGGGCCTATCGCCGCCGCACTC
        GCTGCCCTTGGTGGCGGCCGCCGGTGGCTCTGTGCCACTGGTGGCGCCCAATAATCGGCGAATCCATCGGGTGGTCCACT
        CGAAGTTGCCCACCGTCCAGGAGGGTGCGACAATAGGACGTTATAGTCCAGTGCGTCGAGCATCGGAGGGATCGAAGAGT
        CAGTTCCAAGGACCACTGCAGGAATGCCAGTCCCTGCAGAAAGGTATTGCACAGAGAAACTTTTTGGTTGCACCCAGTCC
        GCCGCTTTTAGAAAATTCGATCAGTTTGCCAGGTTCGCCCATACATGGAAAACCGGGCATGGGTTTGCAGCTGGCTCTGC
        GTCGCGGCCATGACATCGAAGTTCCTCCGGAAGCCATCAAGAATCTGATGCCCGCATTGGATCGACTGGTTAAGGAGCAG
        CGTGTTAGCTTCGAAATAGCCAACAAAATAATCTCAACGCATGTGGTGCCGATGGACTTGGCTCCGCTCCTGGGACTGGC
        AGCTCATGCTTCGAGTGCGGCGGCGGTTAGTGGAGGTCATCTCGACCAGAGCCACTTCACGCATCTCCAGCAGCAACAGC
        AACAGCAGCACATGCTCAGCTTCAGTGTATCGCCGCTCAGCATGCCGCAGGGCGGAGCTGTGAATGCCTCGCTGACCTCG
        GCCAAGCAGATGTTTGGCCAACCGATCTGTGGCTATACGCAATATCAACCTATGACCCTGGCCCTGCAGCCGCAGCATCA
        ACAGCAGCTGGTTGGCCAGTTTAGCAGCATTAATTTGGGAGCCAGCAACTCGAATTCAAGCAGCGGCTGCCAGTCGCCTG
        TTTTCAGCACCAGCTTCAGCGGTAGTTGCTCGCCCAATCCATACCTGCCAGGTGCCGCCGGTGGCTCTTCGCCGCTGCAT
        CAGATCACTAAGGGCATCTCTGGTTTAAGTACGGGATGTGCTGGTGGTTCTATCACCAGAGGCACTTCAGCAGCCAGCGA
        AGGAGCAGCAGCGGCCGCTGCCGCTAACCAACCTCTAGACCTGTCCATGGATGTTTGCGGCGGGGTAATGGATCAGCAGC
        CCACGGACTATGCAGCAACCAATTGGTTTATGCCCACGGCCTCGTACTACGACATGAAACCCCTTAACCTATCGCCCGCA
        CAACCTGTGAGGGTCGTGCCCACGCCGCCAGCTTCACCCAATTTGTGCATCATCCAGGAGGAGAATGGAAACGGACAGAT
        GTGTCATACTATCAGCACAGGTACTCCATACGCCGGTTGTACGGGAGGAATTACGCCGCAGATATGCCTCACCGATGTCC
        AGGGCAGTGAGATCACTTTGGTGGCTTTATCCTCGGACAATAGTCGTGATAGTGAGGACTCCCTTGAGCAGCACACTCCA
        GTAATGTCACTGCAGGGGCTTATCATCACGGAGCCCAGCAGCGATATGCCTTCAATCACCAGGGGCATTGGACGTAAGGC
        CAGCCTAGACTGCGATTCGGGCGCTGGAAGTCATTGTCCAGTAGCCAGTGGCTCCTCCCACGCTAACCAATCCCAAACAC
        AAGCTCAAACCGAAGCTCAATGCCGGCGTGGCAGTGACAAATCGCTTGGTTTCTCTGATGATTCACTAAGCAATGACTCG
        AATAACCTGTCGCCGTGCCAGGAGCCATCCGCCAGCTCTGGTTTTAAATCGGATTCCCACTCGGAGATGGGCGATCACAC
        GGAATGTGGTCATCTAACGCCCGATTCCATGTGCGACTCGCGGCGCATGTCGGATGAGATGTGTTACGAAGTGCCGCTGC
        CACATGAGTGCTCCAATCTGGACTCCACGCGCATCTTGGAGATGGTTAAGCAGACCATAGACTCGACAATGCCACCGAAG
        GGCTTTGTCCTGCACAAGGGAAGCATTAGCTCGGAGGACAGTGGAGCGGAATCGCGGCATAGCAGTGCCTCGAATGCATC
        CACCTCGAATCCTCTGGCCTGCGAGGCGGCTTCTCTGCTCGCTTCACACTCTGGATATGGAGAGCCAACCACAAATCTCA
        GTTTGGAGTACTCAGGCGGCCTGCAGATCGAGCTTCAAGTGTGCGAGGGACGCAGCCGCGATCATCATGGCGCCGGCAAA
        GGCATCAAGCTGCGTCGCATTTCCGGGGACCAGTTCGAGTATGGAAAGATATGCCAGCAGTTGATAAGCACCATCACCAT
        GCAGCAGGTGGCAGGCTAAATTATGGAATCCCGCCCTGCTAGCTACCCAAAATGACTACTCGCCTTGCCTAAACTCTGCG
        TAGCTGTGATTAAAGTCGATATGTACGATATAGCCATCCTAAACCAGTAGCAATTGGACAGGAGTTATGTTTCAATTTCA
        TAACAAAGTTTATCCCTTTCCCGTTTTTCATGTTCAGTAGCGTAATCAAAATTTTGAATATCAATTATAAATACATTTTT
        CAATTTTTCGTAGGCCACACCGATTCTTAGGTAGTTCAATTCAAAAAGAAACGTGTATATACGTGTAGAAATATTTAAAA
        TATTCGCTAACATATTATATTATATTTTAACGAATAACGCACATGCCAAGATAGTTTAGTGAATTTGTAATACAAATTTG
        GTGGCGCAAGGTTTTTCAGCAACAGGAGCAAGTAAAGTACATTCCAGTAGCCGAAATTTCATACAAAGTAAACCAACGTT
        CGTTCTAGCCGTAATGATTATCAATATTTAGAACTATACTATATATAAATATATCGACTAATGATAATTTTGACTTATGT
        GCAATTCGTAAACGAGATAAAAATGTTTATTTTGTCAACTCAGTTCAATGACTATACGTACATCTATATCTGTATGAGAT
        ATAGATACACTTAATTTTAATATATATAGGTGATTACTAAATCTGTAGTTAGTTTGCAGTGGCAATTAGTAGCTCCGATT
        AGTGGTAAGCTCTTGATTCCGTTAAATTTTAAACATTTTTTATGAGTGTAGTGTGAAAGTTTGTTCTGTTATTATACACA
        CGATCTATGTTTAGAGTTATATTCTACGGATTAAACACAACATTGATAAATCTATTTTTTAATGAAAGACTGCTGTGATT
        TTACATGTAATTAATTTAGAGCGAAAGAAGGTAGGAGTAAATAACAACAAAAAGAAATACAAACAAAAACTACAAATTTC
        AAACCAATTAGTTATATGATTATATAAATAAACAATTGAACTTTATCTTAAATAAATTACCAATTCTCT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0304024
        2983
        FBtr0304025
        5637
        FBtr0340388
        6278
        FBtr0344258
        6020
        FBtr0344259
        6011
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0292995
        1471
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0292993
        702
        FBpp0292994
        1471
        FBpp0309334
        1468
        FBpp0310663
        1382
        FBpp0310664
        1379
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG42856-RC
        Sik3-RC
        Secondary FlyBase IDs
        • FBtr0086606
        • FBtr0113095
        References (0)