Open Close
General Information
Symbol
Dmel\mir-13b-1-RA
Species
D. melanogaster
Annotation Symbol
CR42878-RA
FlyBase ID
FBtr0304170
Feature type
Associated gene
Evidence Rank
Length (nt)
22
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            TATCACAGCCATTTTGACGAGT
            
            Other Products of this Gene
            The Precursor miRNA
            Name
            FlyBase ID
            Length (nt)
            FBtr0304169
            68
            Other miRNA Product(s)
            Name
            FlyBase ID
            Length (nt)
            FBtr0472714
            25
            Comments
            External Crossreferences and Linkouts ( 3 )
            Crossreferences
            miRBase - A searchable database of published miRNA sequences and annotation.
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            RNAcentral - A comprehensive ncRNA sequence collection representing all ncRNA types from a broad range of organisms
            Synonyms and Secondary IDs (2)
            Reported As
            Symbol Synonym
            CR42878-RA
            mir-13b-1-RA
            Secondary FlyBase IDs
              References (0)