Transcript Dmel\mir-996-RM

General Information
Symbol	Dmel\mir-996-RM	Species	D. melanogaster
Annotation Symbol	CR42947-RM	FlyBase ID	FBtr0304319
Feature type	pre_miRNA	Associated gene	Dmel\mir-996

Evidence Rank		Length (nt)	97
Evidence Score

Map ( GBrowse )
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the annotated transcript, internally consistent
End(s) extend beyond the annotated transcript, internally consistent
cDNA Clones, End Sequence Only (ESTs)
Contained within the annotated transcript, internally consistent
End(s) extend beyond the annotated transcript, internally consistent
Sequence
	TCTGACTCTATTTTGTCGGCGAACATGGATCTAGTGCACGGTGGTTCATG ATTAAGTTCGTGACTAGATTTCATGCTCGTCTATTAAGTTGGGTCAG
Other Products of this Gene
Products of the Precursor miRNA
	Name FlyBase ID Length (nt) mir-996-RA FBtr0304320 22
External Crossreferences
	RefSeq - An integrated, non-redundant set of sequences • NR_048510 miRBase - the home of microRNA data • MI0005857
Synonyms
	CR42947-RM mir-996-RM
References ( 0 )
	No references are recorded in FlyBase at present.