Open Close
General Information
Symbol
Dmel\CG43078-RA
Species
D. melanogaster
Annotation Symbol
CG43078-RA
FlyBase ID
FBtr0304807
Feature type
Associated gene
Evidence Rank
Length (nt)
5320
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 8 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGACGTCGAACATGTGAGGCTCAGGCGGCGTACACATATAATACTCTTTTCTTTTCGGTTTTTTTTCAAATTATTATTTT
        TTTTGTTTCTTAATAAATTTAATACAATTTTTAACCGGAGCAACCAATGATACTAACTGAAAGTTCCTACGACTATGGTT
        TATGTTTTCCTCAGTGTCGCTGGCAATTATGTGTCGCTACCTGGCGCTGGAACTGGCCCCACTGAGCAGCCGACCATACT
        ACTGATCAACGGCATCGCCAGCGATTCCCAGCTAGAGGATAAGCAGTCCAAAGCAGCCGCCTTAAAGTTAGCTCTCGATA
        ACAACAACAGCGAGGCAACAGCACCAGCACCAGCCCAGCCACACCAAGTTCCCACCACTCCGGGTGGCTCGCATCTCCTG
        GACTTCGAGTCGCATCTCATCGAGAGCATTGCCGACGAGGCCAGTGGCGTTGGGATCAGGGAACTAACTCCGTTCGAGCA
        AGAATTGCAGCGGGGCACCTCCAAGGCGGGCACCAATGACACAGACCCAGTCATAGAGGTAGAACCAGCTGGTGTTAGGA
        CCAAACAGCCTGTGGAAATCTCACCGCCGGCACATCAAATCGCCGAGGTTGACGAGACGGCCACTCCGTCGGAGGAAGTA
        CGTCGCACTGCCGAGCAGCTGGTGGATGAGATCGAACAGGAGCTGATCCAGGCACTCAGCCGGGATGTAGACGAGGCGCA
        GCGCGTGCACGAGGATCAGGTCCAGCGAGATCGCGACGAGATCAGCGCACTCACTCAACAGGTCGAAGTCCAGTTGAATG
        AGCTGACCGGTATCCTTAAAAACAAGCCCCAGGCGGAGATTGTCTTGGAACTGCCGGCGGAGGAGGAGGAGGAGCAGAAG
        CCGAAGCCATTTGTCGCTGCTCCCAGTGAACTGAAGCTCGTGGAGGTACCCACTCCCAAAACTGAGGCTGAGGAACAGGA
        ACGCAAGGAGTTCATCGACTCACTGCCCCAAATCGAGCAGAATCGCCTGCAGGGAGTCAGTGGATCCGAGGAGACGGATG
        CTCAAAAACTATCGGCAGACTGCAAGAGGGAGTACTACCAATCGCTGAAGAAGTACCTCCTGCACAGCAGCCAGGAGAAG
        CCGCCAGTGCCACTGCAAACATATCGCTGGGAGGACCTCAAACGAGCCAAGGAACGGGGCGGCTATCCCTGGACACATTT
        GTACAAACGCCCACTGGGACCCGATGAGCAGCCGGAAATTGTGCTGCTCCTGCGAAAGTCCCAGGAACTGCGTTTCAAGT
        CCGAGTCTCCCAAGTCCCTGAAAAAGGTACGCTACGACGAGCAGGTGTTGGTGAAGGAGACCGAACGCTACATACAGGAC
        CTTTCCGAGGACGAGGCGGTAGCCACAACCACCGACGACAGCAGCGAAGAGTCCTCCGATTCAGAGACCGAATCGGAACG
        TGATCAGCACAACGAAGACGCTCTGAGTGAGTGCATCTCCTGTGTTTCCGACTCCGTGCTAGCGGTTGGAGGACACGCCC
        GACCACGTAAGACGAATCGGCTGGCCCACATCCGTGACCTCATACGGCGCAGGCGCAGCGGACGCACCCACGAGGACGCC
        CAGTCACTGCCCGGCAACTCCGCTAATCCCAGTCGACAGAGCAGCGTTCACGAACTAGCCCCGCCGCCGGGATCCCTAAT
        TCCCAACGCCGATAAGCCTCCGAAGTCCAGCAAACCCAAGCAAGGATTCGACATCATGAAGAAGCTGAAGAGTCTGGCCG
        AGCGCCAGAAGAAACGGCTGAACATTAAGAGGATCACCCTGAAGAAGGACGAGAAAATCGTTCTCGGCGAGCAGCAGAAG
        ATTATGAAGCTAAAAGCCTCACCCAAGTCGGATCGCGGTGAGATTCCTCACTTCATCGAGAAGCAGGACTCCGACGAAAT
        CCTGGAACTGGTGGAGTACGATGAATCGCCATGCCGCAAGCGAACCAAGGAGGAGCTACTGGAAGATCAGCCCAGTGGCA
        GTGGAAGAGTGCCTGAACCCGATGAGATCATCGAGCTGCCTGTGGTCAAGACTGAGATAGAGGCTCCCACAGTGGAAGTC
        ACCGAGCCTGCAGAGGAAAAAGTGGATCATAAGGAAGAAAAGGAATCGGAAGCAGAGGAGGACCCGCCCAAGAAAACACC
        TCGCATTCGGCGGGAGCATGTATACGAAGAGATTGGCCAGGCTGGATCACAGGAGCTTGTGAATCAGCCAATCCTGGAGC
        TAGAATCTCTAAAGAAATCTCTGACGCGTCAGGACAATCTCGCCATCGATGAGATCGAGGCGGCCAAGGCAGTGCCGCTG
        GATCGCATGGGCAGCAGCGAGGAGGAGCAGGTGACCGCCGGCAAACCCGGTGCGCTATTTGCCCCCATCTCGTCCATAGA
        CTCCACCTCGTCGGATGAAGATCGCGCCCGCCTGGCGCAACTTTCACCCGTTACCGAGGAGAGTGATGAACCCATGGACA
        TCAGTCCAGATCTGCGTCCATCCATCAAGAAGGAAGCTTCCCCAGCGCCCTCAGACAAAAAGGTCACCTTTTCTCACGTC
        GAAGACGAAGCGGAACCGCATCGTGAGGATGTCGAGCTGCCTGAGGATGTCCTGGAGGCGGCTACCAATGCCGCCAAATG
        GAAAAACGAGAGTGATCATGAATACGAGCCCGTGGGCGTGACGCCGGCGCACGAATCCTCGCCAGCACCTAGCCCCCAAA
        GCGAACTGCAGCTGCCCATGGACATCGACTTACCGCTTAGTTCCGCCGGGACCACACCACGCACTGAATCCCGGACTGAT
        TATGAAATCCACACCAGTCAAGTGGACTCAAGCGCCTTGGAGGAGTTGCCGTTGCAGCCGGAGAATCGTCGCAAGGGTTT
        CATGGCTTCGGCACAGGATCGCACCAAGAAGATGCAGGATGGCATACGTTTGCAAGCTGGAAAATTACGCACACGACTCC
        AAACCAAGCCGAAACCAAAACCAGTTTCCGGGAGTCCAAAAGGTAAGGCCAAGGAGCGACGACGCTTTAAGGCTCCCGAG
        TTCTCGAAGATCAAGATGCCTGAGATTAGGCGACCGGATATGTCCAAGCTTAAAGAGCTAAAGCGACCCGAGTTCACCAA
        GTTTAACAAGCCGGACATGTCCAAGTTCAAGTTGCCAGAGAAGTTCTCCACTCTGAAGCTGCGTCGTAGCAAAAGTTTCA
        AGGAAAACGAAGGTGAAGTGGTTTCGGATGAAACCCCGGAAGGCACTGGAGGCACAGCGTCCCCAACTCAGCCGGCGCCA
        AAGAAGAAGTTCGAGTTCAACTTTGGCACCTACCCACGTGCTTTTCGTAAGAAGAAGCCGGTAGAGGAACCAGTTGCGGT
        GGCCACTGAGTCATCATTGGGAACTGAAGGCCTTAGTGTGATTCCCAGCACGGAGACGCAACCGTCGCAGACCTCTACCA
        GCTCTCCGCAAGGTGATCGTGGACCCGGACCCGTTCGTTCCCGCTGGGCGGATAAGTTCTCCGATGTGAGCTACAACGAT
        AGCGAAGGATCACGTTACCGACGCTACGGCAGCGAACTAGAAAGCTTCGACAGAGAATCCTCTCTGGAGCGACGCATGAA
        GGAGGATCTGGAAGGCACCGAAGATACGGCCAGTGAGGCACAGCCCCAACAGGAGATGGGCATTTTGGGCGTGGTGGCCG
        ATAACAAACAGTTTGCCGAATTCGACGAGGAAAACCGGGCCATTCACGAGATATCAAGTAAGAGATCCCGGGAGTTCAAG
        CGCCGCCCTATGGTTCATCAAGATTCTGACCTGCGTTCGGAGGATAGCAGAGATGCTGAAGGCTGGACGGAGAAGGATAT
        ACAGAAGAACAAGCTACTGAGGAAGGCGGAATTGGAGGCGGAGGCTGGCTTTTACAAGTTCCACGACTTACAGGATGCTC
        AATCCACAGCCAGTTCTGGCAAGAAAGTGGTCATGGAGACAATCGATGATGATGAGTTCTTCCTTCGCAAGCGTGGAATT
        TCCGAAGATAACATCCAGTTGCGACAGTACATCAGTGAAGCTATTCGCGAGGGTTACGACATGCCCAATGCCCTTAAGCA
        TGTGGGCTACTCAGCCGAGCAGGTTCCGGCGGAATATGGTGACTACGATGTGCCTCCGGCCAAGCCGCGTCGCCTCCACC
        GAAACTACCAGCCTGACTTCGACTCGCAGGAGTTTCAACGCAGTGATTACGGCGACGATCTATCCATGTCACAAAATGGC
        AGTGAGTTCACTCCAAAGCGACCACTTCGTAAGGCTCGCAGTCGCAGCAAATACTCGATTGAGGGCAGCCAGGACATCCC
        CCAGGATGGTGGTAGCAGTATCCAGTACTTCGAAGATGACGAGGAGTACCTACGGCCGCCGGCCAGAGATCAACCGCTCA
        CGGATTCCGAGCAGGCACTCAATAACCTCGATCTTGGCGGCAAGGCAGCGGCGATGATTCAGGAGGAGATGGAGCAGGAG
        CTACAGAATAAGCCCCGTCCGCAGGCACCGAGGCGCCAGAAGAAACGCACAAGGGACGACGCATCCGTGGACAAGGATGC
        AGACTCCTTCATTAACGGCTTCGGTGGTAGATCAGTATCGAACACCTTTTTGCAGCCACACGAAGATGTAATTGTTTATC
        GCACTGAACACGAATATCGTCACATACCGCTAGCCACGCCGGACAGATTTACGGATGCCACCTCTGCGCGCACACAGCGT
        TCCGAGGACGACCGCACTTCCCGTGGTGCCGACTCCCTGATTCTGGACGGGCACATAAAGTCCCGCGCCGAGCTGGATGA
        CAACGAAGATGTGGGACCACGGACAAGGAGCGATGAGAAGTTCGTCATCGATATGCTGGAGAGTGATGGCTATGCGGTGG
        TCCGCAAGGAACCGCTTCCGAAGCCAACGCCACCTGCCCGCCGGAAGAAGTTCATACGATCGCCGGGTGAGCGGTTCGCC
        ACGTTGCCCAGCATTCGAGGCTCTCGGGGATCACCGCCACCCGAACGACCACCGCCACCACAGCAATACGTGCCCACTGA
        GGACTCTCCGGTGGTGCCACGCCGCAGATCCGCGGCCAGCCTGGACGAGATACCGCTGATGATCAAGTCGAAGTAAGAGT
        ATAGCCTCTTGAGCTTTGACCAATTGAGTTGTTACATTTTTTTGGTTGCCGTTAACTTGTTTCGAATGCATTTTTGTTAA
        GTTTCTATTTAATATTCCTTTGTTGTTAAGTTTTAGACTAGGCTAGGCAATAAGCAACTAATCCGATCCTCCCGAGACAC
        GCACTCCATACACACAATAAAGCCGATCACCACACAACAG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0304809
        5763
        FBtr0304808
        5318
        FBtr0304810
        6099
        FBtr0304811
        5675
        FBtr0304812
        8498
        FBtr0304813
        8664
        FBtr0304814
        8316
        FBtr0304815
        8673
        FBtr0333111
        8538
        FBtr0333112
        8513
        FBtr0333113
        8255
        FBtr0340707
        10607
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0293347
        1653
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0293349
        1709
        FBpp0293348
        1126
        FBpp0293350
        984
        FBpp0293351
        1678
        FBpp0293352
        2455
        FBpp0293353
        2540
        FBpp0293354
        1957
        FBpp0293355
        2509
        FBpp0305322
        2464
        FBpp0305323
        2514
        FBpp0305324
        2428
        FBpp0309526
        2509
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG43078-RA
        Secondary FlyBase IDs
        • FBtr0076629
        References (0)