Open Close
General Information
Symbol
Dmel\CG43078-RB
Species
D. melanogaster
Annotation Symbol
CG43078-RB
FlyBase ID
FBtr0304809
Feature type
Associated gene
Evidence Rank
Length (nt)
5763
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 3 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CGCATGGACGGACCAGCGGACTCCGTGCGCGATTTTCATTCACTTTTCACCCAACTTCTCGGTTCTCAGTTCGCGGTTAT
          ATATATATATATATATATATATACATATATAGATAATACCAAACCGACCAGTAGTTAACGAAGCAACCGGCCACCGGTTC
          ACTTGTCCAGCAGTTCATCAGTTTAACGGCGGCAGTTGGGAGGAAAACTCATCATTATCCGTAATAATCGTTAAAGTTAG
          AGCTTTTACCCCACCTCCTCCATGAGCCTCGAATTCAAACTTCGCGTTGTCACGTAATGCCCATACAATTTAATTTTATA
          ATTAAATTTTTTTGGAATATATCGTACTGAGGGGTGAAGCAAGTGCTGTCGCCATTTCTCGTGATTTTTTGGCAACCAAA
          AAGTAAATCTTAGCCAGCAACCGCATCCGCAAAAATGGAGTCGAAACGCTCGAAAAAAGGACGCAAATCTCGGCCATCTG
          AGTCCGAGCATCCATCTAACCAACAGCAGGAGCAGCAGCCACATCACCATCATCCCTGGGACGAAGACCCTTCGGCAAAG
          AGTCCCCAAGCAAATAGGGCAATTCCCAGCACGGGCACAGCACTGACCCGCTTCCTGACCTGCATGGCACCAGTGATTGT
          GTCGCTACCTGGCGCTGGAACTGGCCCCACTGAGCAGCCGACCATACTACTGATCAACGGCATCGCCAGCGATTCCCAGC
          TAGAGGATAAGCAGTCCAAAGCAGCCGCCTTAAAGTTAGCTCTCGATAACAACAACAGCGAGGCAACAGCACCAGCACCA
          GCCCAGCCACACCAAGTTCCCACCACTCCGGGTGGCTCGCATCTCCTGGACTTCGAGTCGCATCTCATCGAGAGCATTGC
          CGACGAGGCCAGTGGCGTTGGGATCAGGGAACTAACTCCGTTCGAGCAAGAATTGCAGCGGGGCACCTCCAAGGCGGGCA
          CCAATGACACAGACCCAGTCATAGAGGTAGAACCAGCTGGTGTTAGGACCAAACAGCCTGTGGAAATCTCACCGCCGGCA
          CATCAAATCGCCGAGGTTGACGAGACGGCCACTCCGTCGGAGGAAGTACGTCGCACTGCCGAGCAGCTGGTGGATGAGAT
          CGAACAGGAGCTGATCCAGGCACTCAGCCGGGATGTAGACGAGGCGCAGCGCGTGCACGAGGATCAGGTCCAGCGAGATC
          GCGACGAGATCAGCGCACTCACTCAACAGGTCGAAGTCCAGTTGAATGAGCTGACCGGTATCCTTAAAAACAAGCCCCAG
          GCGGAGATTGTCTTGGAACTGCCGGCGGAGGAGGAGGAGGAGCAGAAGCCGAAGCCATTTGTCGCTGCTCCCAGTGAACT
          GAAGCTCGTGGAGGTACCCACTCCCAAAACTGAGGCTGAGGAACAGGAACGCAAGGAGTTCATCGACTCACTGCCCCAAA
          TCGAGCAGAATCGCCTGCAGGGAGTCAGTGGATCCGAGGAGACGGATGCTCAAAAACTATCGGCAGACTGCAAGAGGGAG
          TACTACCAATCGCTGAAGAAGTACCTCCTGCACAGCAGCCAGGAGAAGCCGCCAGTGCCACTGCAAACATATCGCTGGGA
          GGACCTCAAACGAGCCAAGGAACGGGGCGGCTATCCCTGGACACATTTGTACAAACGCCCACTGGGACCCGATGAGCAGC
          CGGAAATTGTGCTGCTCCTGCGAAAGTCCCAGGAACTGCGTTTCAAGTCCGAGTCTCCCAAGTCCCTGAAAAAGGTACGC
          TACGACGAGCAGGTGTTGGTGAAGGAGACCGAACGCTACATACAGGACCTTTCCGAGGACGAGGCGGTAGCCACAACCAC
          CGACGACAGCAGCGAAGAGTCCTCCGATTCAGAGACCGAATCGGAACGTGATCAGCACAACGAAGACGCTCTGAGTGAGT
          GCATCTCCTGTGTTTCCGACTCCGTGCTAGCGGTTGGAGGACACGCCCGACCACGTAAGACGAATCGGCTGGCCCACATC
          CGTGACCTCATACGGCGCAGGCGCAGCGGACGCACCCACGAGGACGCCCAGTCACTGCCCGGCAACTCCGCTAATCCCAG
          TCGACAGAGCAGCGTTCACGAACTAGCCCCGCCGCCGGGATCCCTAATTCCCAACGCCGATAAGCCTCCGAAGTCCAGCA
          AACCCAAGCAAGGATTCGACATCATGAAGAAGCTGAAGAGTCTGGCCGAGCGCCAGAAGAAACGGCTGAACATTAAGAGG
          ATCACCCTGAAGAAGGACGAGAAAATCGTTCTCGGCGAGCAGCAGAAGATTATGAAGCTAAAAGCCTCACCCAAGTCGGA
          TCGCGGTGAGATTCCTCACTTCATCGAGAAGCAGGACTCCGACGAAATCCTGGAACTGGTGGAGTACGATGAATCGCCAT
          GCCGCAAGCGAACCAAGGAGGAGCTACTGGAAGATCAGCCCAGTGGCAGTGGAAGAGTGCCTGAACCCGATGAGATCATC
          GAGCTGCCTGTGGTCAAGACTGAGATAGAGGCTCCCACAGTGGAAGTCACCGAGCCTGCAGAGGAAAAAGTGGATCATAA
          GGAAGAAAAGGAATCGGAAGCAGAGGAGGACCCGCCCAAGAAAACACCTCGCATTCGGCGGGAGCATGTATACGAAGAGA
          TTGGCCAGGCTGGATCACAGGAGCTTGTGAATCAGCCAATCCTGGAGCTAGAATCTCTAAAGAAATCTCTGACGCGTCAG
          GACAATCTCGCCATCGATGAGATCGAGGCGGCCAAGGCAGTGCCGCTGGATCGCATGGGCAGCAGCGAGGAGGAGCAGGT
          GACCGCCGGCAAACCCGGTGCGCTATTTGCCCCCATCTCGTCCATAGACTCCACCTCGTCGGATGAAGATCGCGCCCGCC
          TGGCGCAACTTTCACCCGTTACCGAGGAGAGTGATGAACCCATGGACATCAGTCCAGATCTGCGTCCATCCATCAAGAAG
          GAAGCTTCCCCAGCGCCCTCAGACAAAAAGGTCACCTTTTCTCACGTCGAAGACGAAGCGGAACCGCATCGTGAGGATGT
          CGAGCTGCCTGAGGATGTCCTGGAGGCGGCTACCAATGCCGCCAAATGGAAAAACGAGAGTGATCATGAATACGAGCCCG
          TGGGCGTGACGCCGGCGCACGAATCCTCGCCAGCACCTAGCCCCCAAAGCGAACTGCAGCTGCCCATGGACATCGACTTA
          CCGCTTAGTTCCGCCGGGACCACACCACGCACTGAATCCCGGACTGATTATGAAATCCACACCAGTCAAGTGGACTCAAG
          CGCCTTGGAGGAGTTGCCGTTGCAGCCGGAGAATCGTCGCAAGGGTTTCATGGCTTCGGCACAGGATCGCACCAAGAAGA
          TGCAGGATGGCATACGTTTGCAAGCTGGAAAATTACGCACACGACTCCAAACCAAGCCGAAACCAAAACCAGTTTCCGGG
          AGTCCAAAAGGTAAGGCCAAGGAGCGACGACGCTTTAAGGCTCCCGAGTTCTCGAAGATCAAGATGCCTGAGATTAGGCG
          ACCGGATATGTCCAAGCTTAAAGAGCTAAAGCGACCCGAGTTCACCAAGTTTAACAAGCCGGACATGTCCAAGTTCAAGT
          TGCCAGAGAAGTTCTCCACTCTGAAGCTGCGTCGTAGCAAAAGTTTCAAGGAAAACGAAGGTGAAGTGGTTTCGGATGAA
          ACCCCGGAAGGCACTGGAGGCACAGCGTCCCCAACTCAGCCGGCGCCAAAGAAGAAGTTCGAGTTCAACTTTGGCACCTA
          CCCACGTGCTTTTCGTAAGAAGAAGCCGGTAGAGGAACCAGTTGCGGTGGCCACTGAGTCATCATTGGGAACTGAAGGCC
          TTAGTGTGATTCCCAGCACGGAGACGCAACCGTCGCAGACCTCTACCAGCTCTCCGCAAGGTGATCGTGGACCCGGACCC
          GTTCGTTCCCGCTGGGCGGATAAGTTCTCCGATGTGAGCTACAACGATAGCGAAGGATCACGTTACCGACGCTACGGCAG
          CGAACTAGAAAGCTTCGACAGAGAATCCTCTCTGGAGCGACGCATGAAGGAGGATCTGGAAGGCACCGAAGATACGGCCA
          GTGAGGCACAGCCCCAACAGGAGATGGGCATTTTGGGCGTGGTGGCCGATAACAAACAGTTTGCCGAATTCGACGAGGAA
          AACCGGGCCATTCACGAGATATCAAGTAAGAGATCCCGGGAGTTCAAGCGCCGCCCTATGGTTCATCAAGATTCTGACCT
          GCGTTCGGAGGATAGCAGAGATGCTGAAGGCTGGACGGAGAAGGATATACAGAAGAACAAGCTACTGAGGAAGGCGGAAT
          TGGAGGCGGAGGCTGGCTTTTACAAGTTCCACGACTTACAGGATGCTCAATCCACAGCCAGTTCTGGCAAGAAAGTGGTC
          ATGGAGACAATCGATGATGATGAGTTCTTCCTTCGCAAGCGTGGAATTTCCGAAGATAACATCCAGTTGCGACAGTACAT
          CAGTGAAGCTATTCGCGAGGGTTACGACATGCCCAATGCCCTTAAGCATGTGGGCTACTCAGCCGAGCAGGTTCCGGCGG
          AATATGGTGACTACGATGTGCCTCCGGCCAAGCCGCGTCGCCTCCACCGAAACTACCAGCCTGACTTCGACTCGCAGGAG
          TTTCAACGCAGTGATTACGGCGACGATCTATCCATGTCACAAAATGGCAGTGAGTTCACTCCAAAGCGACCACTTCGTAA
          GGCTCGCAGTCGCAGCAAATACTCGATTGAGGGCAGCCAGGACATCCCCCAGGATGGTGGTAGCAGTATCCAGTACTTCG
          AAGATGACGAGGAGTACCTACGGCCGCCGGCCAGAGATCAACCGCTCACGGATTCCGAGCAGGCACTCAATAACCTCGAT
          CTTGGCGGCAAGGCAGCGGCGATGATTCAGGAGGAGATGGAGCAGGAGCTACAGAATAAGCCCCGTCCGCAGGCACCGAG
          GCGCCAGAAGAAACGCACAAGGGACGACGCATCCGTGGACAAGGATGCAGACTCCTTCATTAACGGCTTCGGTGGTAGAT
          CAGTATCGAACACCTTTTTGCAGCCACACGAAGATGTAATTGTTTATCGCACTGAACACGAATATCGTCACATACCGCTA
          GCCACGCCGGACAGATTTACGGATGCCACCTCTGCGCGCACACAGCGTTCCGAGGACGACCGCACTTCCCGTGGTGCCGA
          CTCCCTGATTCTGGACGGGCACATAAAGTCCCGCGCCGAGCTGGATGACAACGAAGATGTGGGACCACGGACAAGGAGCG
          ATGAGAAGTTCGTCATCGATATGCTGGAGAGTGATGGCTATGCGGTGGTCCGCAAGGAACCGCTTCCGAAGCCAACGCCA
          CCTGCCCGCCGGAAGAAGTTCATACGATCGCCGGGTGAGCGGTTCGCCACGTTGCCCAGCATTCGAGGCTCTCGGGGATC
          ACCGCCACCCGAACGACCACCGCCACCACAGCAATACGTGCCCACTGAGGACTCTCCGGTGGTGCCACGCCGCAGATCCG
          CGGCCAGCCTGGACGAGATACCGCTGATGATCAAGTCGAAGTAAGAGTATAGCCTCTTGAGCTTTGACCAATTGAGTTGT
          TACATTTTTTTGGTTGCCGTTAACTTGTTTCGAATGCATTTTTGTTAAGTTTCTATTTAATATTCCTTTGTTGTTAAGTT
          TTAGACTAGGCTAGGCAATAAGCAACTAATCCGATCCTCCCGAGACACGCACTCCATACACACAATAAAGCCGATCACCA
          CAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0304807
          5320
          FBtr0304808
          5318
          FBtr0304810
          6099
          FBtr0304811
          5675
          FBtr0304812
          8498
          FBtr0304813
          8664
          FBtr0304814
          8316
          FBtr0304815
          8673
          FBtr0333111
          8538
          FBtr0333112
          8513
          FBtr0333113
          8255
          FBtr0340707
          10607
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0293349
          1709
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0293347
          1653
          FBpp0293348
          1126
          FBpp0293350
          984
          FBpp0293351
          1678
          FBpp0293352
          2455
          FBpp0293353
          2540
          FBpp0293354
          1957
          FBpp0293355
          2509
          FBpp0305322
          2464
          FBpp0305323
          2514
          FBpp0305324
          2428
          FBpp0309526
          2509
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG43078-RB
          Secondary FlyBase IDs
          • FBtr0076628
          References (0)