Open Close
General Information
Symbol
Dmel\Rbp-RF
Species
D. melanogaster
Annotation Symbol
CG43073-RF
FlyBase ID
FBtr0304826
Feature type
Associated gene
Evidence Rank
Length (nt)
8410
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 16 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CACTCTGCTCTGGCACACTGAGCACCGAGCTGGCAGTTGGGTAGAAATCAGAGTGCGCCAGCAGCGCGACCGAGATGACC
          CACTTTTCGGTATTCGCACTGAGACCCAACTGCTACTACCCACAGAAAGTGGACAACTAGGCGGAGTTTTTTTCTATATA
          GTAGCAGTGAAACGATCGCGTTTTTCGGATATATTATGTACAGCCTACGTAGCCTAGTGTAAACTATATGCATTTATGTG
          AATTTCCCAGCGCAAACGTGGAAGAGGAAAACAGGCGACCTGAAAAAGCAGCAGCAGCAGCAAGCAAGAAGCAGAAGCAC
          AAGCAGCAAAAAAGTCGTCCGAGGGGCAGCCACAGCATGCCGTACGAGTCGATGCACCATCATCAGTCGGCGGCCGCTGC
          CGTGGCCGCTGGCACCACCCCCAACGGAATGCTGGACGCCCTCAGCCTGCAGCTGCGCGATGCCGAGATGCGGCGCACGG
          AGATCGAGCGGGCGCATCAGGAAACCCTGGCACAAATACGCAATCTGAGCGGTAGCGCTCGTCCCGATGCCGAGGCGGTG
          GAGAATCTGCAGTCGAGAGCCCGGGAACTGGAAAAGAAGGTTGCGCTGGAAAATGTGCGCTGCGAGGAGCTGCAAATCGA
          ACTGACGTCGGCTCTGAAGGCCAAACAGGCATCCCGCTCGGCCTGCTCCGGAATGGGGAGCGTGTCCTCCGGTGGCGGCG
          CGACCATTCCTACATCGGCCAGCAGCTCCACCGTCACTTGGGCACCGACAATCAGCCACCAGGACCAAGGATCCGAGATT
          GATATCATAATGGCAAAGATTGAGCAGGATAATCGCGTGCTGGCCGAGCTGGAACAACCTCGCACCTCGGCCAGCGCCAG
          CATGTCAGCATTGCCGCCCAGTTCCATGTTGAGCACGGTAAATAGCGAATTTAGAACCATATCAAAGAGTGAACTCGAAG
          AAGAACTGAACCGCTACAAAAGAGCAGTTCTGGGAGGAAGCGGAGGAGGAGGAGGTGGCGTCGGCGGCGGCGGCGGCGGT
          GTCTCCGCCCTATCCTCCGGCTACTCAAGCCTGCCGCAATCGCTGGCCTCCACGCTGCCCAATGGTGGGGCCAGCACCAG
          CTTGAGCGGCACCAGTCTTGGCTCGCACAGCGCGGCCGCCGCTGCTGCCGCCCACAGCGTCTCCGCTGGATCGGGAGGCG
          TGGTCGGGGGCGGCGGCCAAGGCGGCCTATCATCCATATCGGCCCTGGTGCCCAACTCAATCAGCGGCATATCCTCGAGT
          CTAAGCAGCCATGCCATTCAATCGATGCAGTACGGAACCGGACAGACGTCCGTGGAGAAACTGCTGAGCGGAACTAGTGG
          AATCACTGGCATTCCACCCCTGCCGGTAAATATTCACACGATGAAGGCTATGCCAACGGCATTAAGTCAGCGCGGAACAA
          TACAGCTGTACAATTTGCAGAGCACAACCATGCCCCTCCTGTCACTCAACTCGCATAACCTGCCGCCCGCCGGCTCGACC
          AGCTACTCAGCTTTGGGCGCCGGTGGCGGCACCTCGCTGACGCACCCGACCATGGCCAATCTGGGCCTGCTGGACACCGG
          CACCCTACTGGGTTCCACCGGCTTGAGCGGATTGGGCGTGGGACCAAGTGTTGGCGGCATCACTGGAGCCACATCTCTGT
          ACGGCCTAAGCGGTGGCGGCGGAGGAGCCGGTGGTCTGGGCAGCTCCTATGGTCCGCCGTTCCTGGACGTGGCGTCGAGC
          GCCTCGTATCCATTCACCGCGGCCGCCCTGCGACAGGCTTCCAAAATGAAAATGCTGGACGAGATTGACATACCGCTGAC
          GCGGTACAACCGCAGCTCGCCCTGCTCACCCATTCCGCCGAACAACTGGGGACTGGACGAGTTCACCGACGGCCTCAGTG
          TCTCCATGATGCATAACCGCGGCGGTCTGGCACTGGGTGCCCTAGATTTGGACACTCGCAATCATGGCCTAAATGGAGCC
          AGTGAACCGCAGGTGGATATGCTCGATATTCCTGGAAAGGGCCGCTGCTGCGTATTCATAGCCAGATTTCCCTATGATCC
          TCCAGATGTTCATAATGAATTCCTTTCCATGCCTTGCAGGGAGGCTGAGGGCGAGCTCTCCCTGTGCGCCGGCGACTATC
          TGCTGGTGTGGACCAGTGGTGAGCCCCAAGGTGGCTACCTAGATGCGGAGCTGCTGGACGGGCGACGCGGCCTTGTTCCT
          GCCTCCTTTGTGCAACGCTTAGTAGGCGACGACCTCCTGGAGTTCCACCAGGCGGTGCTGTCGACGCTGCGCGATGCCGA
          GGACGGATCGATGCAGTGCGACACCACGTCGCTGCCCTCCTTGCCACCGCACAACCCATTGCTCACACACACCCACGAGG
          ATCTGGCACGCTTAAGTGAGACGCACACCGATCTGGAGCACGACCAGGACGACATCAGCGACAATGTTCCAGCACCCAAG
          CACTTGACGCTGGAACGGCAGCTGAACAAGAGCGTGCTCATTGGCTGGTCGCCGCCGGAGCCAGTGGGCTACAACCTCAT
          CGACAGCTACCACGTCTACGTGGACGGCGTGCTCAAGGTCACCGTGAAGGCCAACGAACGCACACGCGCGCTTATCGAGG
          GCGTTGACTCCACGCGGCCGCATCGCATCAGCGTGCGGAGCGTAACCCAGAACCGACAGACATCGCGGGATGCCGCCTGC
          ACGATGATCATCGGGCGGGACACCGCTCATCTGGGCCCCTCGGCGGTGCGCGCCTCGCACATAACTTGTTCCTCGGCGGT
          CATCTCGTGGCTGCCGGCCAACTCGAACCACCAGCACGTGGTGTGTGTAAACAATGTGGAGGTGCGCACCGTCAAGCCGG
          GCATGTATAGGCATACAATCACTGGCCTGGCGCCGAGCACCCAGTACCGGGTGACGGTGCGGGCCAAGCATCTGCGGGCC
          GTGGGCCAGCATGCGGCGAATGTGGGCCAAACGGGCGGAGCTGGGCGGCCGGGACAGGAGGAGGCGCCCGGAGCGTATGC
          TGACTTCCGCACCCTCACCAAGGGCCTGCCCGATCCGCCGCAGGAGATTCAGCTAGAGGCCGGTCCGCAGGATGGTACCA
          TTCTGGTGACATGGCAGCCGGTTAACAGGCCCACCTCGACGGGGCCTGTAACCGGCTATGCTGTGTACGCCGATGGTAAG
          AAGGTCACCGACATTAACTCGCCCACCGGCGACCACGCCCTCATCGACATTGGCAAGCTGGGCGTCTTCAATCCGCGTGC
          CGTGACCATACGCACCAAGTCCCGCGATTCCCAGTCGGCGGACAGTGCGCCCATCTTGATACCAAACACTGTGCGCAATG
          CGGTGGCTCGCAGGGGTCCCAATCAGATGGGCATGGGTCCGCAATTGCCGCAGGGACCGCACGGGATGACGGTGCAGCAG
          CAGATGGGCGGCATGCCCGGCCAGCCGGGTCAACAGGGCCAGCACATGATGGGTGGGCAGCAGGATCACGGCCAGTACGA
          TCCCAATCAGATGCAGCAGCAGCAACAGCAGCAGGGTCAGCCGGGTCAACCGGGTCATCAGCCCGACGCAGGCTCCGGAT
          TGTTAGGTGGCCTTCTCGGTGGCCTCTTCTCGAAACCCACACAGAATCAAGTGAACCAGAATGGCTATCAGCCAGGCCAA
          CCAGGAGCGCAACGGGGCATGGTCCCGATTCCAGGAAGACCGCAGGGACCACAGCAACAGCAGCAGCAGCCCTACGGACC
          CCAGGGTCCCATGGGTGGGCCACGCTTTCGAGGACCAGTTCCCGGCCAGCTTAATATGCAGGGCCAGCAGATGCAGGGGC
          AAATGCAAGGGCAGATGCAAGGGCAGATGCAGGGTCAGATGTCGGGTCAGATGCCCGGTCAAATGCCTGGACAAATGCCT
          GGTCAAATGCCAGGTCAGATGGCTGGACAAATGGCTGGTCAGATGCCTGGCCAGATGCCAGGTCAAATGCCCGGTCAGAT
          GTCCGGTCAGATGCCTGGCCAGATGATGGGACCACGAGGACCGCTCAATCAGCAGCAACAGCAGCAGCAGCAGATGCAGC
          AGGGCCAGATGATGCCCGGCCAGCAGGCAGGACAGCAGCAGGCCCAGCCCGGTCAACCGGGACAACCGGGTCAGATGCCC
          GGAGCACAGAAGAAGCCCCGCTATTTTGTGGCCATGTTCGACTACGACCCATCCACGATGAGTCCAAATCCCGATGGCTG
          CGACGAAGAGCTGCCCTTCCAGGAGGGCGACACGATCAAGGTATTTGGTGATAAGGATGCGGATGGCTTCTACTGGGGCG
          AGTTACGTGGCCGCCGAGGCTATGTGCCGCACAACATGGTCTCCGAGGTGGAGGACACCACCGCCTCCATGACTGCCGGT
          GGACAGATGCCCGGTCAAATGCCGGGCCAGATGGGCCAGGGCCAGGGAGTCGGCGTGGGCGGCACCGCCCAGGTGATGCC
          CGGCCAAGGTGCTCCGCAGCAGAGCATGCGCAACGTGAGCCGCGACCGCTGGGGTGACATCTATGCCAACATGCCCGTGA
          AGCGAATGATCGCGCTCTACGACTACGATCCCCAGGAGTTGAGTCCCAATGTGGATGCCGAGCAGGTGGAATTGTGTTTC
          AAGACGGGCGAAATCATACTCGTCTACGGTGATATGGATGAAGACGGTTTCTACATGGGCGAACTGGACGGCGTGCGCGG
          CCTGGTGCCGTCTAACTTCCTGGCGGACGCGCCCGACCAGTACAACAACCAGATGGGTCCGGGCGGAGTGGCCGGCCGCG
          GCGGTCTGAGCCAACGGGGCAGGGGTCAGGGGCCAGGAGCGAGGGGGCCGCCGCCCCCGCCACGTGACAACATGATGCCC
          GGAATGGGCGGGCGCGGCCAGCCGGGCAAAAATGCTCGCCCTGCTTCCCCTACACTGTTAGACAACACGGGCCATCCTGC
          CCCCGATCACCAAACGCAGGGGATGATCGGTCGCGTTGGTAATGTTGGCCTGCAGCAGCAACAGCAACAGCAGCAGCAGC
          AGCAGCAACTCCAACAGCAGCAGCAGTACGGTCAGCAACAGACGCAGATGGGACAGCAGCAGCAGCAACAGCAGCAAATG
          GGACAACCTGGAATGATGGGTCAGCAAATGGGTCAGCCGATGGGTCAGCAAATGGGACAGATGGGTCAAATGGGTCAGAT
          GGGTCAGCAGCAGATGGGACAGCAGCAGATGGGACAGCAGCAGCAGCCGCCGACGACACAGGCGCAAACGGGCGGACTAT
          TCTCCGGCGCGACTAGCCTGCTCTCTGGTGCTACCTCGGCTGCCACCGGTGGTCTATTTGGGTCGAAGCAACCGCCCAAG
          ACGGATCCAATGCAACCACAAGGTGGTGTGCAGCCAGCGCAGCAACAAGCAAACGCCTTTGGTGCCCAGCAGCCTGGCAT
          GGGCATGCAGCAGCAGGGGGGAATGCAGTCCGGAATGCAGCAGGGCATGCAGCAGGGCATGCAGCAGGGTATGCAGCAAG
          GGATGCAGCAAGGGATGCAGCAGGGGATGCAGCAGGGCATGCAGCAGGGTATGCAGCCCGGAATGCAGCAGCAGCAGCAG
          CAGCCACAACAAGTGCCACCGCAAGCCCAGGCGCCGCCTCCAGGACCGGGCGCCGGATTGCTGGGCGGGCTCAAGGGCAT
          CGCGGCAGCGGCGCCCGGCGGCGATGTCCTGTCGAAAGGCAAAGACCTCTTCGGAAAATTCGGGTTCGGCTTTGGCAAAT
          AACCCCGGTCATTCTATAGGGTCCTGTTATATTATTCGTAGATTAGTCTTATTATTACTATTATGATTATGATTATTGCT
          ATTGATTACGATTACTAAGCTAATATAAAGTAAAACACAAAAATGATAATGATGAACAGACAAACCAATGCTAAAGTTAA
          AACCCATACCCGGTTCCGAACTGTAGGCCAATGCATATGTTGTTGTTCTCGTTGATATGAAATGATATGATATGATATGA
          CTAATAGTACTAATACTAATGGTAATATTTTTTATTAATTAAATTAATGAAAATATTATGAGTGACCGACGGACAACAGC
          AGCATCGGCCAAACAGCCGGGCCACAAAAAAAAAAAACCAAAAAAATTACAAAAAAAACAAAGCCACAGAAAAGCCCAGA
          TAAATTGTTGTAAAATTATTTAACAAATTGCCTGCCGGTTTAGGTGACTGCAACTCCATTAACCCACTAAAAGGATAAAG
          CTCTATAATACAAGACCACACACACACACATATATACACAGATGCAATACACACCCATCACATAGATACTGAACACACAT
          ATATTATACAAATACAAGTAAGCGAGGAGAAGAAATATATTATATACATACATTATATTTACAATTATTTGTTAACGCAC
          ATTGTTAAATTTGCTACTGTTGCTGACCAGTTTATAAATAAAAACCAAAAAAGAGACGAGGAACGATAGAGAAAAGAAGA
          TTTATGAGAAGATAAAGCAAACACATAAGCTAAACTAAACCGAACATAAACATAAACATACATATATTATATGTATATAT
          TTAAAATATATTGAAAACTAAATTGAAATACACTAAAATTACATTTATAAATCAAAACACAACCGAATGTTGAGCAATGT
          CAGACGAGCGGAATGACGAAAAACAAAAAATACATACATTAAAGTAAATAAATAAATCGATATGGTACATATTTACATAT
          ATTCGCATATACTAAATACGATTTCGCATTCAAGCCAACCTCAAATCGGGCGCATTTCCAAGACTAGGCGACCTTGACTT
          CCAGTCCAGTACAAGAAGATCACTTTCCCCAAACCCCAAACCCCAAATCCCAATCCCAATCCACTCTATTCTCAATCCAG
          TGATAGCCTGAGCCAAATTCCCATCCCTATACCAAAATTCCCAGTTCCAAAAAAACCCAAATCGAAAGCCTTCGACTACT
          CGACTCAAAACTTCTATTCAACGCCCCACTTTCTCAGTGTTTGATGTCCATAGAAGCCATATGCGATAAATATCAGTGTA
          ACTTAAAGCAAACCAAAGACCAAGAGAGATCTACTCCTACATAAATACATATATGGGATACCCAAATGGCAAATACAAAC
          ATAATGTACTAAGCACAAGATCGTAGCGTTATAGACCCAGAATACCCAGAAGATCAAAAAAGCCCCAGGAGACATGTTCA
          CTAAATTCAGCAAGGAGACTTTCTCACACCTTCTTTAGCAACTTAAGCCGCCCCTTGCTACTAAGTACTTCCTATCGCTA
          TCTATCTACCCCTGCCTATCAAAAGTACACTCTTTCGAACGTTATTTTAATATCAATTACTACCAATTACAAGTTACCAA
          CTACTACCGATAGTTAGTTACGCCGCATACGACCAGTTCGGTGGCTAGTTCTCTCACGAGAAAGCCTGCTTTTGAACCGG
          ATCGAGAGAAGATAGTCAAATGTTTCCTAATGTTTAAAATTGCTTTGACTCAGCGCCCTCATACACTCGGCATACAGAAA
          CAAATACATTGCGTACCTCTTGCTTTACGAAGAAATACAAACATTCAAGATGTGAAGAGTATAAAGATAACAAAGTATAT
          TAATGAAAAAATCTACCAAACAAATACATTAAACGAGGCATATTTAAAGAGCGCATAGAGTTGCATATGTACATGTGCTT
          GGCCGGCAAAAATAATTGTGAGCAAACGATTACTTTAGACACACACACACAAAAACACACACTTACTACAGAACGACACA
          TACATAGATACATAGATACACTGCAATTAAACCAAACACTGTAAATTGTAACCAAGCAAATGTGCAGTAGTGTGCGGGCA
          GAAAAAATTAGATATCGGAATTAGCCAGATGTTTTGAATGGAGACGGACTTACCGAAATCGAAACAAGCGTTAACTTTTC
          CCACGTAACTGATTTAAATCTTACAATCAAGTCACTGTATTATTATTCAGCCACATCGGAACTACAATTACAATCTACAA
          GCCTAACTTCGGCATCCACCGAAGCCGTTAAGTTCCCGAAAAACCGGAAAATATATCACATCCGAAATACGGGGACTGAC
          CGGAAATACACACAGACACAAACACAGATACAGATACAGTTACGGATACGGACACTGACAAATGCAGACATACACACTCT
          ATAATCATTTACTAGAAACACCTATACAACTATACAACAGTTTATTTCCTCGGAAACCAAGCGAACAATATAGAATAAAT
          GAAATTAAATTCCCATTAAACACACACTGGCAAAACAGAAAAAAAAAGAAATGATAATGGCAATGAGTACTATGCAATAT
          GAAATGGATAAACAAAACAAATGAAAACCAACTAAATTGTTATACTGTATTATTATACTTTTTCTATAAATTATAATTTC
          CTTATTGAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0304827
          5797
          FBtr0333832
          6581
          FBtr0333833
          6118
          FBtr0433493
          8251
          FBtr0433494
          6405
          FBtr0433495
          8302
          FBtr0433496
          5848
          FBtr0433497
          5654
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0293366
          1844
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0293367
          1817
          FBpp0305966
          1799
          FBpp0305967
          1763
          FBpp0390599
          1748
          FBpp0390600
          1487
          FBpp0390601
          1765
          FBpp0390602
          1791
          FBpp0390603
          1473
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          Transcriptional initiation is supported by short-capped RNA data (FBrf0209722) and RAMPAGE TSS data (FBrf0220331).

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG43073-RF
          Rbp-RF
          Secondary FlyBase IDs
            References (0)