Open Close
General Information
Symbol
Dmel\shot-RAA
Species
D. melanogaster
Annotation Symbol
CG18076-RAA
FlyBase ID
FBtr0304850
Feature type
Associated gene
Evidence Rank
Length (nt)
17845
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 59 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AGTTCGGCGAAACTCGGGAAATCGGAAGGTTCAACTTTTGGGGCGATTAAGTATTATAATTTAGCAAATATGTTGCTAGC
      CAAATTCTAGTTAGCTAAAAATTAAGATTAAGTACAGGGAAACTCGAGTGCAATCAAAGTAAACACAAGAGGCTGACGCA
      GCACATACGCATCCGTGAAAACTCGGGAAACTCCGCATCACGCAGCCACAAGAAACGGCAACAACACGGCGTCCCCCCGC
      AATTACGTCCGCTCGCGCTCCACCCCCCAGTCGCCCCACTCCCCGCAGGCGGCACTCCTCGGCGGCGTCGGAGGCGGTCG
      ATCCCACGGATCCTCCCACCATCATCATCATCCGTACCACCATCATTCGCCGTCACCATCGCCATCCGCACCATCGCCGT
      CGTGCCCCACGTTGCAGTTGCAGCCGCGATTGCATCAATCGGAGCAGCAGCTGTGCCAGCGACGCCGCATCTATGCGTCC
      ACGGGGAGTGCCGCCAACATCATGATGGATCGCGAATCCCTTAGCGAATGGGCTAAGGACAAGCCGCTCAGCATCCTGCA
      GCTGGATCCGGCGGATCGTGCGGTTCTCCGCATAGCAGACGAACGCGATGCCATTCAGAAGAAGACTTTCACAAAATGGG
      TTAACAAACATCTGAAAAAGACCTATACTATGCTACATGTTTGTGTAACCACAAATGGCATACCCTGTTGTTCTCAGTCT
      GCCAATCGTCGTGTGGTGGACTTGTTCGAAGATCTGCGCGATGGTCACAATTTACTTTCACTCCTGGAGGTGCTATCTGG
      CGAACACCTGCCACGCGAGAAGGGTAAAATGCGTTTCCATATGCTGCAGAATGCACAAATGGCTCTGGACTTTTTGCGCT
      ACAAGAAGATCAAACTGGTCAACATACGCGCCGAGGATATTGTGGATGGCAATCCAAAGTTAACCCTGGGCCTGATCTGG
      ACCATCATATTGCACTTCCAGATCTCCGATATTGTTGTGGGCAAAGAGGACAACGTATCCGCTCGGGAGGCTCTGCTGCG
      CTGGGCACGTCGCTCCACTGCTCGGTATCCGGGCGTACGTGTCAACGACTTTACGTCGTCGTGGCGAGATGGATTGGCTT
      TCTCGGCGTTGGTGCACCGCAACCGACCGGACTTGCTTGACTGGCGAAAGGCAAGGAACGATCGGCCACGGGAGCGCCTG
      GAGACGGCCTTCCACATTGTGGAGAAGGAGTACGGAGTTACGCGTCTGTTGGATCCTGAGGATGTGGATACCAACGAGCC
      GGATGAGAAGTCCCTTATCACGTACATTTCATCGCTGTACGATGTGTTCCCGGAGCCACCCTCTATCCATCCACTCTTTG
      ACATGGAGTCACAACGTCGCGTTCATGAATACCGCGACCTGGCCCAACAGTTCATCTACTGGTGCCGCGAGAAGACCGCC
      TACCTGCAGGAGCGTTCCTTCCCGCCCACGCTAATTGAGATGAAGCGTCTGTTGAGCGATCTGCAGCGTTTCCGCAGCGA
      CGAGGTAAGCGCCCGCAAGCGCGAGAAATCCAAGCTCATCCAGATCTACAAGGAGCTGGAGCGCTACTTCGAAACAGTGG
      GTGAAGTCGACGTAGAGGCTGAACTGCGGCCGGATGCCATCGAGAAGGCCTGGTATCGCATGAACACGGCGCTGCAGGAT
      CGCGAGGTTATCCTTCAGCAGGAAATTGAGCGACTAGAACGGCTGCAACGACTGGCCGATAAGGTTCAGCGCGAGATCAA
      GCATGTAGATCAGAAGCTTACCGATCTTGAGGGCCGAATTGGCGAGGAAGGTCGCCGCATCGAGCGACTACATCCCGTGG
      ACGCTAAGAGCATTGTCGAGGCGCTTGAAACCGAGATCCGGCACCTGGAGGAACCCATCCAGGACATGAACCAGGACTGC
      CACGTGCTCAACGAGGGTCGCTATCCTCATGTCAGTGAGCTGCACAAGAAGGTCAACAAATTGCACCAGCGTTGGGCTCA
      ACTGCGCACCAATTTCCACACGAACCTGGTACAGAAGCTGTCCGGTTTGAAGTATCCCGTCCACGAGACCACGGTGACGC
      GTCAAACGCGCATGGTGGTCGAGTCCCGTCAGATCGACACGAATCCCCATTTCCGCGATCTGCAGGAGCACATTGAGTGG
      TGCCAAAACAAGTTGAAACAATTGCTTGCCGCTGACTATGGCAGTGACCTGCCGTCGGTCAAGGAGGAACTGGATCGCCA
      ACAGCACGAGCACAAGATCATTGATCAGTTCCACACGAAAATACTCAACGACGAACGTCAGCAGACCAAGTTCTCTGGAG
      ATGAGCTGGCTTTGTACCAACAGCGTCTCAATCAGCTGCAGAAGGTGTATGCCGAGTTGCTTAGCACCTCGACGAAGCGT
      CTGTCCGATTTGGATTCGCTGCAGCACTTCCTGGGACAGGCCTCGGCGGAACTGCAATGGCTTAACGAAAAGGAGCAGGT
      GGAGATTACGCGCGACTGGGCGGACAAACAACTCGATCTTCCCTCCGTGCACAGATACTACGAGAACCTTATGTCCGAAC
      TGGAGAAGCGTGAGATGCACTTTGCCACCATCCTGGATCGTGGAGAGGCACTGCTGAACCAGCAGCATCCGGCCTCCAAG
      TGCATCGAAGCCCATCTGACAGCCCTGCAACAGCAATGGGCGTGGCTGCTGCAGCTAACACTCTGCTTGGAGGTTCATTT
      GAAACACGCCACGGAGTACCATCAGTTCTTTGGCGAGATCAAGGATGCCGAGCAGTGGCTGGCCAAGCGTGACGAAATAC
      TCAACAGCAAGTTCTCACAGTCAGACTTTGGCTTGGACCAGGGTGAAACTCTACTCAGGGGAATGCAGGATTTGCGCGAG
      GAACTGAATGCCTTTGGCGAGACAGTGGCCACACTGCAGCGAAGAGCCCAGACAGTGGTGCCTCTAAACAAGCGACGACA
      GCCGGTAAATCGACAAGGACCCGTGCAGGCCATTTGTGCCTACAAACAACAGGGTCAACTGCAGATCGAAAAGGGCGAGA
      CTGTTACGCTGCTGGACAACTCGGGACGTGTGAAGTGGCGCGTGCGCACTGCTAAGGGGCAGGAAGGACCCATACCGGGC
      GCTTGCCTGCTATTGCCACCTCCTGACCAGGAGGCTATCGATGCCGCCGAACGTCTGAAGCGTCTGTTCGATCGATCAGT
      AGCTCTTTGGCAGAAGAAGCATCTGCGACTGCGCCAGAACATGATCTTCGCCACCATTCGTGTGGTTAAGGGCTGGGACT
      TTGACCAGTTCTTGGCCATGGGTCCTGAGCAGCGCACGGCCATCCGGCGTGCCCTCAACGACGATGCCGACAAATTGCTG
      AGCGAGGGTGATCCAAACGATCCGCAGCTGCGACGCCTGCGCCGTGAAATGGACGAGGTCAATCGCTTGTTCGATGAGTT
      CGAGAAGCGTGCGCGCGCCGAAGAGGAGAGCAAACAGGCCAGTCGCATCTTCACCGAGGAATGCCTTGCCATCAAGAGCA
      AACTGGAGGACATGGCCCGTGAGCTGGATCAGATTATACTGGCTCCGTTGCCACGTGATTTGGACTCTTTGGAGCATGTG
      CTGGAAATTCATTCGGACTACGAGCGCAGGTTGCACCTGTTGGAGCCTGAGTTGAAACACCTGCAGGAAACATTCCGCAC
      GATTGCGTTGAAGACGCCAGTGCTGAAGAAGAGCCTGGACAATCTAATGGAGCTGTGGAAGGAGCTGAACACTCAAAGTG
      GCCTGCACAAGGACCGTCTGAAGTTGCTTGAGGCTTCGCTGGCTGGTCTGGAGGACAATGAGCATGTGATTTCCGAACTC
      GAGAACGAGCTGGCCAGGCACCAGGATCTGCCATCGACCGCTGAGGGCCTGCAGCAAGTGTTTAAGCAACTGAACCACAT
      GCAGGACATCATTACACAACAGCAGCCGCAAATGGATAAGATGAACGATGCGGCCGATCAGCTGGGACGCATGGGAGTGC
      CCACCAAGGTGCTCGGCGACCTCAAGAGACTGCACTCGAACGTGGAGCGCCTGAACACGCGCTGGAGTGCGGTGTGCAAC
      CAATTGGGTGAAAGAATGCGCTCATGCGAGACGGCTATCGGGCTTATGAAGAATCTCCAGTCGAGCGTGCAAGTGGAGGA
      ATCATGGGTGGATGGCACCACGGAGCGACTGTCTGCCATGCCCACCGCCACTTCGGCATACGAACTAGATAAACTGCTCG
      GAGCTGCAATCGAACGAAAACCAAAAATCGAAAATGTCAACGTGGCTGGAGGACGACTTATACGCGAAGCTAAGATCTAC
      GATAGCAAATGCCTACGCTTCGTGGACTGGCTGGTCGAGGCCCGTCCGTCGTTCTCGCCACCGCGCCGGGATCTCCGGCC
      GGCGGATAGCGATCCGGGCGCCACACAGTATTACAGCCAACGTTTGGACAACCTGAACACGAAGAACGACAGATTGCTGG
      AACAACTGTCGCAGCGTCTGAAAACAGCAATCGAAGTCAATGGCAGCGATGGTCTGCAATACGCTGAGAGTCTACAGAAA
      CCGCTCAAGACCTTTAGGGTTGACTTCAGTGCGGGCAGCGTGCCAACTGGCGATGGTTACGCTGCGCGCCAGGAGGATCT
      CTACACCACTACCTACAGCACCACACAAATCAGCTCAACGAAGACAACGAAAAGCTCTACGAAGAGCGTCTATAGTAGCG
      ATGGCTTGGACGCCGCTAGTCAGGAGGTTAGCACTGCTGGCCTGCCTCAATCGCAGATCCAATTCAACGAAATCCGTACG
      CTCAAACGCTCTCAACAGCTGGGTGGCCATTCCGTGCTGGATATAGCCGGAATACGCGATCCTCGTACGGGTCGCGTTCT
      AACCATCGGTGAAGCCATCCAGCTTCGCATTCTGGACGTGCGCACCGGCGAGATGCTAGTGGGTGATCGCCGTATCACGC
      TGGAACAAGCTGCCGACCAAGGACTGATCGATTTGCAACTGGCAAAGCAATTGCTTGAGCCTGGTGCCGGCCGAGATGCC
      AGCGGACGGGAGCTGTCGCTCCTGGAGGTTATTCAGCGCGAGATTAGCGAAGCGGAATCCGGTTACGAGACGGCCGAGAA
      GCGGATCAAGCAAGCAGTATTCGAGAAGTTCAACATGTGCGAAGAGAATGTCAACGATCTGTTGAAATGGGTTACCACTG
      TGGAACAGAAAATCTCAAGTGTCGGCGGACCTCGTGAAAAGATTGATGAGTTACGCAACCAGATTAATGCCCTTAAGCAA
      ATCAAGGATGAGATCGAGTCTCAGCAACGGCCAGTTGCCACTTGTTTGGAGCAAATCCGTCAGATCGTGCTCACCGGTGG
      TGATGTTTTGTCTGCCCCCGAAGTGACCACTCTGGAGAACTCTGGCCGGGAGTTGCGTTCGCGTGTGGATCGTGTCAACG
      ATCGCACCGTGCGTTTGCTCCGGCGCCTGGAAGCAGGTCGAGATGAGCTCACCAAACTGCGCAGCGAATTGGATGTATTC
      TCCGATTGGTTGCAAGTCGCCCGACGCACTTTGGAGGACAAGGAACGTTCCCTGTCCGATTTGACTCGGCTGCCCTCTCA
      GGCCGATTCGGTTCGTGAGTTTGTCAGCGATGTGATTGGGCACCAGGCCGATCTGCGGTTCATCACAATGGCCGCACAGA
      AGTTTGTGGACGAGAGCAAGGAGTTCTTGGCCATACTGAACGACTTCCGTACTTCACTGCCCGAACGCTTGCCACATGTT
      GAGCCACTGTCCAGTGCCGAGAGTCCCATACGCCAAGAGGTATCGCTGGTCTCGGCACAGTACAAGGATCTGTTGAACCG
      TGTGAATGCTCTGCAAGATCGCGTCTCCGGTTTGGGTGGACGCCAGCGTGAGTACCAGGATGCATTGGACAAGGCTAACG
      AGTGGCTGAGGAGTGTACATCCGCGTGTGTCGCGCATTATCTCTGAACCGATTGCCGGCGATCCTAAGGGAGTACAGGAT
      CAGATGAACGAGGCCAAGGCTCTACACAATGAGCTGCTTTCTAGTGGTCGCTTGGTGGACAATGCGCAACAGGCACTTGA
      TAATCTGCTGCGCAGCCTTGGTGGCCAACTCAGTCCCATGGAGATCAATCAGTTGGAACTGCCTATTGCCGATCTGAAGA
      ACAACTACCAGCAGCTTCTGGATAATCTTGGTGAGCACTGCAAAACTCTGGACAAAACTTTGGTGCAATCGCAGGGCGTA
      CAGGATGCCTTGGACAGTCTTGTGGGATGGGTTAACCAGGCCGAGGATAAGTTCAAGATGAATCTGCGACCCGCCTCGCT
      TATCAAGGAGCGTCTGCAGGAGCAGATCCGCGAGCACAAGGTCCTGCTAGCCGATCTTCAATCTCACCAGGCCAGCATCG
      ACAGCGTTCAAGTTTCGGCCAAACATCTGCTTGCCAGCGCATCGAATGCACGCATTGCCAAGAAGGTGGAATCGAATCTA
      AACGATGTGACCGTCAAGTTTGAGAAGCTCTACGAGAAGGCCAACAAACGTGGTGAATTCTTAGATGACGTTTACAACCG
      ATTAAGCCGCTATCTGGATGAAATCAGCACCGTGGAGCAGCGTATGGCCAGCTTACAGGAGGCTCTAGATAGCCGCGAGA
      CAAGCCTGCTTTCAACTGAAGAGTTGGCTCGCCGCATGAACGAACTGTCGCGTGACAAGGACCAACTGGCTCCGCAGTTT
      GAGGATTGCGTGCGCAGTGGCAAGGATCTAATTAGCCTGCGTGATGTCACCGATACTGGAGTTTTGCGCGATCGCATCAA
      GGCACTGGAATCTCAGTGGCGCAACATTAACATCAGCATCGATGAGCGCGCCAAGCTGTCCAAGCAAAAGGCCGAACAAC
      AACTGGCCTACGAGGGACTGAAGGATCAGGTCCTCTCCTGGCTGGCCAGCACTGAAGCGCGAGTTAACGGCCTTCCGCCG
      GTAGCAATCGATCTGGACAGGATTAAGCAGCAGCATGACGAGCTGAAGCCCATATGCAAGGATTACCGCGACTATGCACC
      AACTATTGATAAAATTAACGATATTGGAGCACAGTACGATGCGCTAATCCGTCCAGAGAGTCCTGCCCGCAAACGCTCCA
      CTTATAGTCCGATTAAGCGGACCAGTCCGTTGCGCCGCATGTCCGGAGACGCTAGAAGCCCCAGCCCCACCAAGGGAGGC
      ATCCTGTCGCCACTATCGACTGGTTCCAGTGGATTCGGTAGCCGCAGATCCTCCCAGGATGGTTTCCAGCTGTCTGAGCT
      ATCTCCGGTGCAGCAGCAGCTGAGCGAGATCAACAATCGCTACGGGCTGATTGGCGTGCGTCTCAATGACCGCCAACACG
      AGCTGGACAACCTGAACGAGGAACTTCGCAAGCAGTACGAGAATCTGAAGGGACTAGCTCAGTTCCTGGAGCGCATTCAG
      CGCCAATTGCCCAAGGAGTCCGTATCAAACAAGGATGAGGCCGAGCGCTGCATTAAGCAGGCGCGCAAGATCCTCGAAGA
      CATGTACGAGAAGCAGAGTCTTCTTGACACCACCAAGGCTCAGGTGAAGGATATCCTCCGCCGCAAGTCAGATGTGCCCG
      GTGCCGAACAATTGCGCCAGGAGAACGATAGCATCCAAGAGAAGTGGAAGAATCTCAACGACATCTGCAAGAATCGCATT
      GCCTTCTCCGAGAAGCTGCGTGACTTTTTGGACACCCATGGAAATCTGAAGAGCTGGCTGGACAGTAAGGAACGTATGTT
      AACCGTGCTGGGACCCATCTCTTCCGATCCCCGTATGGTCCAGAGCCAGGTGCAGCAGGTGCAAGTGCTTCGCGAGGAAT
      TCCGCACTCAGCAACCACAACTGAAGCATTTCCAGGAGCTTGGACATGATGTTGTCGACCATTTGGCCGGCACACCCGAT
      GCTCAGGCGGTCGAAATCAAACTGAAGGACATTCTGGGCAAGTGGGATGATCTGGTTGGAAAGTTAGACGACCGGGCCAA
      TAGTTTGGGCGGTGCTGCTGACAGTTCCAAGGAGTTCGATGCTGCTGTAAATCGCTTGCGTGAGGCTCTGCAGAACATAA
      GCGATAATCTGGATACTTTGCCCACGGATGGCGATCACCAGGAGAATCTCCGCAAAATCGAGAACCTGGAGCGACAGCTT
      GAGGGTCAACGCCCGCTGTTAGCCGATGTGGAACAATCCGCCGCCACTCTATGCAACATTCTGGGTGATCCCGCCTCGCG
      CGCTGATGTCAACTCTCGTGTCGCAGCTCTGGAGAAACAGTATTTGGCCCTTCAGAAGAAACTGGATACCAAGAAGGCAG
      AAACAGAGGCTTCCCTTCGGGATGGCCGCCACTTTGCCGAGAATTGCTCAAAGACTCTTGGTTGGTTGGGCGGAGAGCTC
      TCCAACCTGACCGACAGGCTTTTGGTCTCTGCACACAAGCCAACACTGCAGCACCAGATTGACACCCATGAGCCGATCTA
      TCGTGAGGTAATGGCCCGTGAGCATGAGGTTATTATGCTAATCAACAAGGGCAAGGATCTAACCGATCGCCAGCAGGATC
      GCGGAGTTAAACGTGATTTGGATCGCATCCAGCAGCAGTGGGAGAAACTGCGCCGTGAAGCCGTCGATCGACACACACGA
      CTGCAGACGTGCATGGAGCACTGCAAGAAGTACTCCCAAACTTCGGAGACATTCCTGGCCTGGCTGCGTACCGCGGAGGA
      TAAGTTGGCTGATCTTACACCCGGCGTATTGTCGAAGGCAAAGCTGGAGACGCGTCTGCGTGATCTGCAGACCTTCCGTA
      GTGAGGTTTGGAAGCATTCCGGTGAATTCGAAAACACCAAGGGATTGGGAGAGACATTCCTCAGCAGCTGCGACATCGAT
      AAGGAACCCATTAAGGCGGAACTTCAAGACATCCGCGATCGTTGGGAGAGACTCAACAATGATCTGATTGCCCGTGCTCA
      TGAAATTGAAAACTGCTCGCGTCGTTTGGACGATTTTAATGATGAGTTGCGAAACCTGGATCATTCTTTAGGTCGTTGCG
      AGGATCGACTTGCTGCCCACGATGCTCTCGGTGGAGCTGCCAAGGATCCCAAACTTTTGGAGCGTGTTAAGGCCATACGC
      GAAGAGCTCACTAACTTGAGCAAGCCTTTGCAGTCACTTAAGGCTCTGGCCAAGGATATCAGTGCTGAGGCTAGAGCTGC
      TGGCGGAGATGCTGATCATTTGACCAGTGAAGTCGATGGCCTGGCCGACCGCATGTCCGAGCTACAGGGTCGCCTGGATG
      ATCGCTGCGGAGAACTGCAATCTGCAGCCACCGCCGTATCCCAATTCAACGAACAAATGAAGAGTTTGGGCATTGATCTG
      AACGATCTGGAGACCGAGATTGAAAAGCTTTCACCGCCCGGTCGAGAAATCAAGATTGTCCAAGTGCAAATCGACGATGT
      TGGCAAGATCCAGACCAAATTGGATCGCCTTGTGGGTCGTTTGGAGGATGCAGAACGTGCCGCTGATGTTTTGGTAGATG
      CAGGATTCGCTGCAGACACCACCCAGACCCGTGAGCAAATCTCCACGCTGCGTAAGACATTGGGTCGTTTGGACAACAGA
      GTTCGCGATCACGAGGATAATCTTCATTCCACTTTGAAAGCACTTCGCGAATTCTACGACCATCAATCGCAAACTCTGGA
      TGACATTCAAGACGTAAGCGATGAGTTCAAGCGCATGAAGCCCGTTGGCTCGGAGTTGGATCAGATTCGCCGCCAGCAAG
      AGGACTTCCGTAACTTCAGGGAGCGCAAGGTGGAACCACTGGCCATCAATGTGGACAAGGTAAACGTTGCTGGCAGAGAC
      CTAGTGCGTTCGGCTGGCAGTGGTGTTTCTACCACGGCCATTGAGAAGGATCTGGAAAAGCTAAACGACCGCTGGAACGA
      TTTGAAGGAGCGAATGAACGAGCGCGATCGCCGTTTGGATGTGGCTCTGCTGCAATCTGGAAAGTTCCAGGAGGCGTTGG
      CCGGTTTATCCAAGTGGCTCAGCGACACCGAGGAGATGGTGGCTAATCAGAAGCCGCCTAGCTCCGATTATAAGGTGGTA
      AAGGCACAGCTTCAGGAGCAAAAGTTCCTCAAGAAAATGCTTTTGGATCGTCAAAACTCTATGGGCTCTCTAGCCAATCT
      CGGCAAGGAAGTTGCCAACCACTGTGAACCCGGCGAACGTGCCTCCATTGAGAAACAGTTGAACGATTTGATGAAACGCT
      TTGATGCCCTGACCGACGGAGCCGAGCAACGTGAGTTGGATCTTGAGGAAGCCATGGAAGTGGCTAAGCGATTCCATGAC
      AAGATTAGTCCCTTGGAACTTTGGCTGGACAACACGGAGCGATCTGTTAAGGCAATGGAACTGATACCTACTGACGAAGA
      GAAGATCCAGCAGCGAATCCGCGAACACGACCGTCTACACGACGAAATCTTGGGAAAGAAGCCCGACTTTTCCGACCTTG
      CCGATGTCACCGCCCAGCTGATGCATTTGGTTAGCGACGAGGAAGCCGTTAATCTGGGCGAGAAGGTGCGCGGTGTGACA
      GAGCGGTACACAGGATTGGTGGATGCCAGCGACAACATTGGGGCTCTGCTAGCCGAATCACGCCAGGGATTGCGTCACTT
      GGTCTTGAGCTATCAGGATCTGGTGGCCTGGATGGAAAGTATGGAAGCCGAGTTGAAGCGCTTTAAGTCCGTTCCCGTTT
      ACGCTGAAAAGCTGCTGGAACAGATGGATCATCTGTTGGAGCTAAACGAGAACATTGCCGGTCACGCTTCGAATGTGGAA
      TCTACTGTGGAATCCGGAGCCGAGCTGATGAAGCACATTTCCAACGATGAAGCTATCCAACTGAAGGACAAGTTAGACTC
      CCTGCAACGTCGCTATGGCGATTTGACCAACCGTGGTGGAGATCTGCTGAAGAGTGCACAGAATGCACTACCATTGGTGC
      AGCAATTCCATGAAGCTCACAACCGTTTAGTGGAATGGATGCAAAGTGCTGAAGCTGCTCTTGCTCCCAGCGAGCCACGT
      CAAGCTGATGTGCTTCGGCTGGAGGGTGAATTGGCTGATATGCGTCCTATTCTGGACAGTATCAATCAAGTGGGACCCCA
      GCTGTGTCAGCTTTCTCCGGGAGAAGGTGCTGCCACCATTGAGAGCATTGTGACCCGGGACAACCGTCGCTTCGATTCCA
      TTGTGGAGCAAATTCAACGCAAGGCGGAGCGTCTCCACCTGAGCAACCAGCGCGCCAAGGAAGTGACAGGTGACATTGAT
      GAACTGCTTGAGTGGTTCCGCGAAATGGACACCACTCTTCGTGAAGCCGATCTGCCTGCCATGGAGCCCAAGTTGGTGCG
      TGCCCAATTGCAGGAGCATCGTTCTATCAACGATGACATTTCCAGCCAGAAGGGACGTGTACGAGATGTTACTGCGGCCT
      CCAAGAAGGTGCTCCGCGAGTCCCCACAGAGCGAGAACACCGCCACTCTTCGTGAGAAATTGGATGATCTGAAGGAGATC
      GTCGACACTGTTGCTCAATTGTGCAGCGAGCGTCTGGGCATCCTGGAACAGGCTCTGCCCCTGTCTGAACATTTCGCCGA
      TTCCCATCAGGGACTCACCGCCTGGTTGGATGACATGGAGCAGCAGATTTCGCGATTGAGCATGCCGGCTTTGCGTCCTG
      ACCAGATCACTCTGCAGCAGGACAAGAACGAACGTCTTCTTCAATCCATAGCGGAACATAAACCTCTGCTAGACAAACTG
      AACAAGACTGGTGAGGCTTTGGGTGCATTGGTGGCCGATGATGATGGTGCTAAGATCAACGAGATTTTGGACACGGACAA
      TGCCCGTTATGCCGCACTCCGCTTGGAACTCCGCGAACGGCAGCAGGCGCTCGAGAGTGCTCTGCAGGAATCCAGCCAGT
      TCTCCGATAAACTGGAGGGCATGCTGCGTGCTCTGGCCAACACCGTGGATCAGGTCAATCAATTAGATCCCCTGTCCGCT
      CTTCCGCAGAAGATACGTGAGCAGATCGAGGATAATGATGCTTTGATGGACGATCTGGACAAGCGACAGGATGCCTTCAG
      TGCTGTGCAGCGTGCGGCCAACGATGTTATCGCTAAGGCTGGCAACAAAGCTGATCCAGCTGTGCGTGACATTAAGGCCA
      AGCTGGAGAAGCTGAACAATCTCTGGAACGATGTACAGAATGCCACCAAGAAGCGCGGCAGCTCGTTGGACGACATCCTA
      AGCGTAGCCGAACCCTTCTGGAAGCAACTGAACAGCGTAATGAAGACCCTAAAGGATCTAGAGGAAACACTATCTTGCCA
      GGAGCCACCAGCGGCCCAGCCTCAGGACATTAAGAAACAACAGGTGGCGCTGCAGGAAATCCGCCATGAGATCGACCAGA
      CCAAACCAGAGGTCGAGCAGGTGCGACGTCACGGAAGCAACCTGATGAACATGTGCGGCGAGCCCGACAAGCCAGAGGTC
      AAGAAACACATCGAGGACTTGGACAACGCATGGGACAACATCACGGCGCTGTATGCCAAGCGCGAGGAGAACCTCATCGA
      TGCCATGGAGAAGGCCATGGAGTTCCACGAGACACTGCAGAACCTCCTCAAGTTCTTGACCAAGGCCGAGGACAAGTTTG
      CCCATCTGGGAGCTGTGGGTTCGGACATTGATGCCGTCAAGCGACAGATTGAACAACTCAAGTCGTTCAAGGATGAAGTC
      GATCCGCATATGGTTGAAGTAGAAGCATTAAACAGACAAGCTGTGGAACTGACGGAACGCACTTCACCCGAGCAAGCGGC
      ATCGATTCGCGAACCCCTGTCGGTGGTCAATCGCCGCTGGGAGGCCCTACTCCGTGGCATGGTCGAGCGCCAGAAGCAAC
      TGGAGCACGCTCTGCTGCACTTGGGTCAATTCCAGCATGCTCTCAACGAGCTGCTGGTATGGATCAACAAGACCGACAGC
      ACACTGGACCAACTGAAGCCGATTCCTGGAGATCCGCAACTGCTAGAGGTTGAATTGGCCAAGCTAAAGGTGCTGGCCAA
      CGACATTCAGGCCCACCAGAACTCAGTGGACACACTGAACGATGCGGGCCGACAGTTGATTGAAACCGAGAAGGGATCTG
      TGGAGGCGTCTACTACCCAGGAGAAGCTGCGCAAACTGAACAACGAGTGGAAGCAGCTTCTGCAAAAGGCCAGCGACCGT
      CAGCATGAACTGGAGGAGGCTCTACGTGAAGCTCACGGATATATTGCCGAGGTCCAGGATATTCTGGGATGGCTGGGCGA
      TGTAGACGCAGTGATTGGAGCTAGCAAGCCTGTGGGCGGACTTCCCGAGACTGCTACTGAGCAACTGGAACGTTTCATGG
      AGGTGTACAACGAGCTGGATGAAAACAGACCCAAGGTGGAGACGATTCAGGCCCAGGGCCAGGAGTACATCAAGCGTCAG
      AACCAAATGAAGGTCTCGTCCAGCAACTTACAGCATACACTCCGCACGCTGAAGCAACGTTGGGATGCCGTGGTATCCCG
      TGCATCCGACAAGAAGATTAAGTTGGAAATTGCACTCAAGGAAGCCACCGAGTTCCATGACACACTGCAAGCCTTTGTTG
      AATGGCTGACCCAGGCCGAAAAGCTGTTGTCCAATGCTGAACCCGTCTCACGCGTTCTGGAAACCATTCAGGCCCAGATG
      GAGGAGCACAAGGTGCTGCAGAAGGATGTGAGCACTCATCGCGAAGCCATGCTGCTGCTGGACAAGAAGGGAACTCACCT
      TAAGTACTTCAGCCAGAAGCAGGACGTGATCTTGATTAAGAACCTGCTCGTGTCGGTGCAACATCGTTGGGAACGAGTGG
      TTAGCAAGGCTGCGGAACGCACTCGTGCTCTGGACCATGGCTACAAAGAGGCTCGCGAGTTCAACGACGCCTGGAGTGGC
      ATGATGCAGTATCTGCAGGAAACCGAACAAGTGCTGGATCAAATTATCGAGGAAGCCACAGCGTCCAAGGAACCACAAAA
      GATCAAGAAGTACATTGGCAAGCTGAAAGAGACGCATCGTCAACTGGGCGCCAAGCAATCGGTCTACGACGGAACCATGC
      GCACCGGAAAGAATCTTTTGGAGCGAGCTCCCAAGGGCGATCGCCCTGTGTTGGACAAAATGCTGATCGAACTGAAGGAA
      CAATGGACTCGAGTGTGGTCCAAGAGCATCGATCGCCAGCGCAAGCTGGAGGAGGCTTTGCTTCTTTCTGGACAGTTCAG
      CGATGCTCTGGGTGAGCTTCTTGACTGGTTGAAGAAGGCTAAGAGCCGCCTGAACGAAAATGGACCAGTCCACGGAGATT
      TGGAGACGGTTCAAGGTCTATGCGAGCACCACAAGCACATTGAGCAGGATCTGCAGAAGCGCGCTGCGCAAATGCAAGGA
      GTGCTCAAGACTGGACGCGACCTGGAGCGATCTGGAAACAATCCCGAAGTTGGACGTCAGCTCGATGAGATGCAGTCCAT
      TTGGGAGGAGGTCAAGAGTGCCGTCGCCAAACGCGGCGAGCGTCTCCAGGTGGCCCTTGTTGATGCCGAGAAGCTTAATG
      CCCGTGTCCAGGCTCTCTTTGATTGGCTGGATCATGCCGAGCACAAGCTACGATATGCCAAGAATGCCCCTGATGACGAG
      AAGGTGTCCCGTGAAATGATGGACATCCACATGGACTTCATGAAGGACCTGCGAGTGCGCGAGCGTGAAAAGACCGAGAC
      TTTTGAGTACGCCGAGGACATTATCAACAAGGCCTATCCCGATGCCATTCCGATCATCAAGAACTGGCTTTCGATTATCC
      AGCAGCGTTGGGAGGAGGTGCGCCAATGGGCCATCAATCGTGAGTCGAAGCTGGAGCAGCATCTGCAGTCGCTCAAGGAT
      TTGGACGACACCATTGAGGAGCTGTTGGCTTGGCTCAGCGGACTCGAGGGCACCTTGTTGAACCTGAAGCACGAACAGCT
      GCCGGACGAGATTCCACCCGTGGAGAAATTGATCGAGGACCACAAGGAGTTCATGGAAAACACTGCTCGCCGTCAAAACG
      AAGTGGACCGCGCATGCAAACCAAGACAGTTGCCACCAGGAGCGCGCAAGCCGTCGCGCAGCGGCAAGACGCCAGTTCGT
      GGCTCCAGTCACGATCTGCGTGAGCAGTCACCCGACGGCACCCTGAGGCGTCAAAGCTTTAAGGGATCTCGTGACCAGGG
      ACTCAATGCCCGCAAGGGAAGTCGTATCACGCCCACACGTGACACGCCCGACAGAGATCGCCTGCCGCACTATGGCCCCC
      GATTCTCGCCAAGCACCTCGGGACCGGAACTGGAATTCCGTTCGCCACGCGCGAAGCTTCTGTGGACCAAGTGGCGCGAT
      GTCTGGATGCTCTCATGGGAGCGCCAGCGGCTGCTTAACGATCATCTTCTGTATCTGAAGGATGTGGAGCGTGCCCGCAA
      CTTCAGCTGGGACGATTGGCGCAAGCGCTTCCTCAAGTACATGAACCACAAGAAGTCGCGCTTGACGGATCTGTTCCGGA
      AAATGGATAAGGATAACAATGGCATGATTCCGCGCGATGTCTTCATCGATGGCATACTCAATACGAAATTCGATACATCT
      GGCTTGGAAATGAAGGCTGTAGCCGATTTGTTCGATCGCAATGGCGAAGGCCTCATCGACTGGCAAGAGTTCATTGCTGC
      CCTTCGTCCCGATTGGCAAGAGCGTAAGCCAGCCAATGATTCGGACAAAATACACGATGAGGTCAAACGTCTGGTCATGC
      TGTGTACCTGCCGACAGAAGTTCCGTGTGTTCCAAGTTGGCGAGGGCAAGTACAGATTTGGAGACTCCCAGAAACTGCGC
      CTCGTTCGTATCCTTCGCAGCACTGTTATGGTGCGCGTGGGTGGCGGTTGGGTTGCCCTGGATGAATTCCTGCAGAAGAA
      CGATCCTTGTCGCGCCAAAGGACGCACTAACATAGAGCTACGCGAGCAATTCATATTGGCCGATGGCGTCTCGCAGAGCA
      TGGCCGCATTCACGCCCAGACGTTCCACGCCAAATGCGGCCGCCACTGCCTCCTCCTCACCCCATGCCCACAATGGCGGC
      AGCTCCAACTTGCCCCCATATATGAGTGGACAGGGTCCCATCATCAAGGTACGCGAGCGCTCCGTCCGCTCGATTCCCAT
      GTCACGACCGTCGCGCTCCTCACTTTCGGCCAGCACTCCCGACTCCCTGAGCGACAACGAGGGTAGCCATGGAGGACCTT
      CCGGCCGGTACACACCACGCAAGGTCACCTACACGAGCACGCGCACGGGTCTCACGCCAGGAGGCTCTCGTGCCGGCTCC
      AAGCCCAACTCGCGCCCGCTCAGCAGACAGGGATCAAAGCCGCCATCGCGACATGGCTCCACGCTGTCGCTAGATAGCAC
      GGACGATCACACGCCCTCACGCATTCCGCAACGCAAGCCTTCAACGGGCAGCACAGCCAGCGGTACCACTCCGCGTCCGG
      CGCGACTTTCGGTGACCACCACCACGACTCCCGGCAGTCGTCTCAATGGCACCAGCACCATTACCCGCAAAACCGCCTCC
      GGATCGGCTAGTCCGGCGCCCACAAGGCGAAACATCAGCGGTAGCTCAACGCCCTCCGGGATGCAAACGCCGCGAAAGAG
      CTCAGCGGAGCCCACATTCAGCTCCACAATGAGACGCACTTCGCGGGGAACCACACCGACGGAGAAGCGTGAGCCATTCC
      GGCTATAGGAAGCCACCGTTATGGCTGAGGACGACGACGATAGAGAAGCAAAAGAATGCCAATATTTAAACCACATACAA
      AACACTCAACTCTACGTACTAACTACGCACTGAAGTTCTAAACTAAACCCCCCAAAAACCACTCCCCAAACTAATCGAGG
      CTACATTAGCAATGAATGTAGCAGCAGGAACAGCACACAGTTCTACAAAAGAGACTAACTTTGAAGTGCCCTAATGGATT
      GGTGGAGCGAAACAATTTATAGATGTTTATACTATATATATTTTGTAAAAGACACAGTTAAGATGAAAGTTATGCAGACA
      TATAGCTAGCACACAAAGTTGATCAGACAAGCAACCTACTTACGAGTACTACTACTACTAATACTACCTTTTGCTACTAC
      TAATTTGTAATGCCCACTACCTTTATTCACTAGTTATACACGTTTCCAAAATTATGATTTGTATATACTTATAAAGCGAA
      AAGCAAGCGTAAATTAATGAAAAATACACTCCAAGTGCTCTACGGCAATTAAACAAACAAAAACAAAAAAAATACAAACA
      AAAACACATAAAAAATATCGAAAAACTTAAGTGAAAAAAATAAAACATTCGAATGAAATGCCGCGGTCTCTGCTGCAAAC
      CATCTTGAGTCTCAGTTCTCCACTGGAATCGCCAGTCCGGTGGAATTCTAGCCAGGAGTGGCACGTGGCAGAGGCGGAAC
      GGCCAAAAAAATAATAACTAAACCCGTTAAAGAGATAAAATTTGATTTTGTTCTGTTATTAAACTAATAGGAAAGTGAAA
      ATTGTAAGCCGCATAAAGAAAATATTTAATTATATACTAAAAGTCATTACTATAAGTTTAATTAATATTTAACTGTTAAG
      CGACAAACACACACACACACACAGATTTTGTATTGCATAATTATTATGTTTTTTATATGCAATATATCAGCGAATGAATT
      ACGATGCAGATGCAGAAGGGCGAAAGAAATCGAACCCGTTTCTATAAATACTGTAAAATACTAATACTAAATTATTTTGT
      TGTACGAAACGAAAGAAATGCATTAAAACTCGTGTTTTGTAATTCTATTTAATTAAAACAATTCAAATGCGAAATAAACA
      TTTAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0087619
      18014
      FBtr0304851
      13661
      FBtr0304852
      17813
      FBtr0304853
      17148
      FBtr0087616
      17791
      FBtr0087620
      16907
      FBtr0087618
      17114
      FBtr0087617
      17776
      FBtr0087621
      27842
      FBtr0273222
      17746
      FBtr0273223
      17725
      FBtr0273224
      17731
      FBtr0273225
      17969
      FBtr0273226
      17948
      FBtr0301591
      17785
      FBtr0301592
      18008
      FBtr0301593
      17801
      FBtr0301964
      16892
      FBtr0304847
      17729
      FBtr0304848
      18016
      FBtr0304849
      17803
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0293390
      5408
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0086745
      5501
      FBpp0293391
      4100
      FBpp0293392
      5462
      FBpp0293393
      5434
      FBpp0086742
      5390
      FBpp0086746
      5160
      FBpp0086744
      5201
      FBpp0086743
      5385
      FBpp0086747
      8805
      FBpp0271730
      5375
      FBpp0271731
      5368
      FBpp0271732
      5370
      FBpp0271733
      5486
      FBpp0271734
      5479
      FBpp0290806
      5388
      FBpp0290807
      5499
      FBpp0290808
      5458
      FBpp0291176
      5155
      FBpp0293387
      5434
      FBpp0293388
      5463
      FBpp0293389
      5394
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      shot-RAA
      Secondary FlyBase IDs
        References (0)