Open Close
General Information
Symbol
Dmel\CG2225-RG
Species
D. melanogaster
Annotation Symbol
CG2225-RG
FlyBase ID
FBtr0304885
Feature type
Associated gene
Evidence Rank
Length (nt)
5627
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTGCTTTCGTGTTGTCGGAAAGTCGGTGATAAGTAGGTTCTCTGGTCTCTGGCATGGGCATTTTCATGTGTGTTTGAGAT
          AAAAGCCCATTGCGAAATTAGAATATTCTCGGACATAACCGTTCAAAGCCGATGGTACCGTGCTTTAAGTGTCGCCGCGG
          CGTCTGCCATTCGTGGACCCCCTGCCCTCTTCGCTTTGAGTTTTCTATTATTAGCAGCTTTTCGCTTCGAAAGACTTCTG
          TTTGACCATTTTGTGAGCCGACAGCAGAAGCTTCCGAACAACTCCAGGCAGTCGAAAAAGTCGGTTCGCCTTGTCGGCAG
          TTAGTGCATGTGTCTGCATTTGAAAAAATCGATGCCAGACTGCAGAAACTTCATTGAGAACGAAAAGGAGTGAGAAGATG
          AAAGCCAACAGCAGAAAACCTTAAGATGACGAATTTAAGGACCTAGAAATAAAACTGCGAGGAAGGTCGAGCAAAACCTC
          CAATCACTTTCACTCATTGCATACATGAACATTAAAACTGCCGCCGATAAAGCAGCGTCGCTGACTGGGAAATTGTAGTT
          ATCAAAATATCCGACATCAACAAAGAAACCACTGCCGACGAGCTCTACCGCCGATGGTTTAATGAACATCCCATAATGGC
          AGCGGCACATGAATCGCCTAAAGCACGCGATTCGACCAACGTCGAGACTGAGCGGACGTTTCAGCTGGAGGCAGGGCAAT
          CCTATGACACAATGGCAGAATCTCATCGCGCATTCCATTCCCTGGAATTGGAGGCGGGAGCGGAGGTAGCCGTAGATGCC
          GCTGTTGAAGCTGACTCAAAAAGACAAAACGATAATCAACTGCAGTCGTTGGAACCCATTTCCTTGGATGACATACCCGA
          ACCAATAAAAGTCCTCGACGAGATTATTTCCGAATTTGAGGAGGCAGCAACGAAACCAGTGGCCTTGAACTGCAATAGTG
          GCGAGAATCAGTCCGAGGACGATGGCTACATGAGCCTAAGTCGCAAGAACATGTCCAAAAAGGATTCCGAAGATGTGCCC
          CAAACACCCAGCACAGACACTGTGCCAGAGGGAAGCTTCAACGAAGTGGATGGTACGGCTGAGAATCTAACTAAATTATC
          TGAGGTTGTACACGGACAGGAAACTACATCGCCTCTCATTCAGACAACGCTGCCAAAGGCTAGAGGATCTAGCTCAACTC
          CTGCCGTAAGCTCAAACTACTCTAGTTTACCGTGCTGTGGTGTCAGGGCTTCGAATTTGGGTGGAGTTTCTGCTGCCAAT
          TCATCAAGTGGATTGTCAGCCATCCGGCATCCAGGCAGCTGCAACGGGGGTCGCAACGCACTGGGCATCGACATTAGCGC
          TGTTCATAACGCTGTTCTGCGTGGTAATTTGGCGAAGCTGCCGGAACCATTCGTCAACGAACATCCAGTGACGATATACC
          CAGGTCCCTCTTCTAAGACAGCCGTGGGGGAGGGAGCTCGCTGCAAGCGACTACTCAGCTCTGTCGAAAAGCACAAGGAA
          GTGTGCCACATGCTAAATCCACTATCCAGCGGCTCAAACTCTTCGTCCGGGGAGGCTTCGCCTGCTGCGTCTCACGTCAA
          TGTGGCGAAATCAAAAGCTGCTGCCAGGGATGACGAATATTCGGAAGATTCGCTGGAGGAGTCAACCATCTCTACTGAAC
          TTACACCCGTTAAACAGAACGGAGTCGCCTGGGAGATTCACTTTAGAAACAGCAAGAAGAAATCCAGTGGCTTCAAAAAT
          ACGTCTGCATCTAAAACGGTGCGATCGTTAATAGTTTTTAACATCGTTAAGAAAAGCAACAATTTAGACGACAGTTTCAT
          GTACAACGAAAGAAGCATGCTGGGCAAAGGGACTTTTATTATCCGTCGCTCCACAGCCAAAAAACCGCCTCGTGTCACAG
          ATGTATTTTGTATACCAAAGCCACCACGTTCCTCGTTGGCCGAGGGAGTCGGGCCAGAGACCAAAGTTGGAGCCGGGGCG
          ATCAGTAATGAGTTCTACACAAGCGATAGCGAGCAAAGCGATGCCACACCCCTACCACCACCGCTGCCACCAGCTTCACC
          TGACATAAACTTCGTGTACAAGGAGTGTGAGGCTAATGTGGAGCATACACGCCGGGGATTGGAGATGGTCGTCGCACACC
          GAGCGATCTTATCTCTTGATATCGAGGCACCAGAACAACTTGGCTATTGCAAGCCTGTGAAGAGTAAGACGGCGATGCTA
          ACAGAAAAGCGCCTGAGTGCCGAGTCCATGCCGGACAACACATCCAGCAGCGAAGAGTTCGAAGAGGCTCGTCTGAACGG
          AATCGGCAGCTACGAGTTGTATGGTTACAACGGTAACGATCAGCGAGCTTCCAATGCCACCACTCCGCATACAGATTTGG
          CCCCAACTCTGGAGGAGGACGAAGAACTTTCAGATTTAAGCTATGGGTGTGCTCCACTGATGCAAATAGAGCATAACATC
          AGTGCTTTGTTGCGTGGAGACCTTCCAATTATCGGCCAACCGGCTGAGAGGAAAGGAGGTGGGCTTACTGGTGCCGCAAC
          GACAGCTGCCGAGCAGCATGCAAAGCGGGTGCTAGAATTTCGACATGGCGTTCACAAGTCTGAAAGCGCCAAGGAGATGC
          TGCTGTCACAGATGCCCAGTTTGGGCCCACTGCCACCATCGCCGCCGAATTCCAACCCGGATTTATTTGACTACAATGCC
          CCTCTTCCACCGTCACCGGTGGAGCCGCGAAAGCAGCTAGAGCTCCCTGTAGTGCCGAATGCCCCTCCCGCGAATCGGGG
          CACTACCGTAGTGGAGGTGCATGCCACCGCCTCTGGTACGGCGGTGCACAGTAGCAACAGCCACACTCGCCGCAGTCGGG
          ACAATATCGCCTCTGTGCGTCACTTTACCGACGAGCTGCCACCGCCTCCAGCGCCTTCCCACCAATCGGCCAGCTTCTTA
          GAGGGCAACGGCGGACCACCTACGGTCCCCCCACATCGAGTGACTGGAGGTCATTCGGCTAATACAATGAAATCCTGGAG
          TATCGACTCGCAATACCGCAAGAAATCGCCAAAGCTATTTGGTCATTATAGCAGCGGTGGCAGTGGGATAACCACACCCA
          CTGGTCTGGGACCGATTGCTCCACTGCCCCCTCCACATTTCGACGGAATGGCAGGTGGATCTGGGTCCTACCATCGTCGT
          TATATTAACTATGGCACCAAGCGCAGCCTAAAGCAGTCGCCGCGCGAAGAGCATCGCCTGCAAACCTCATGTAGTCTTCC
          TGAAACGCCAATTTTTGCCAGAGGCTGTGACATACCACGTACCCCATATCGACGCCAAAATGAGCCCCTGCCTGTGGTCA
          GTGGCTCCCGCACAGCGCCCAGATCGAGCACATCGAACAGCATCAACATGGGCGCTTCAATTTTGGGGATCGGAGGTGGT
          AACTATGGTACAGCCCAAATTTGCCGTCAGCGCTCAATAAATCATGCCTTGGCCTCCAACGAAATGCTTCGCATGACCGG
          GGCCCCGGCTCGAGGATGGTATCCCAAGCAACGGGGAATGCGACCCGTCTCCACCGAGAACATAGATCGAATGGCTTCCA
          TGCGGGTGTGGGACAATCCGACGGTCATGTCGGGCACCGGACAATCTCGTAAGCCTTTAACACTGCCACCAAATCTTACA
          CCTTCCTTCTTGAATAAATCACCCCGCGAGGCTCTACGGCGTGTTACTAGTTTGCTGATAACCAAAAAAAAAAACAGCAA
          AGATCGAAAACATAAGGCGTACTGCGATCAGCTTATGGATGATAGCAACAGCAAGCATGTCTATGAATTTGAATCGGGAT
          CCACCACGCGAAAGGATACCAATCGCAAAGACAATGGAGCCTCGGGGGCGACCACGAATAACAAACCTAAAAAAAAGGGG
          CTTTTTAAATCTCTTTGGAAACGCTCCAAAACGGTCTCTTTAGATCAGTAAAAATCCCCTCTTGGATATACCCCTTGTTT
          TATATACACATACATATGTGTATAGTAGCATCGAAAATTATAATAACCGTGCATTAACTTCTATCGGGTCGAAACCTGCC
          AGTTCATCTTTGCACTCACCTAGTCACTCACCTGCTCATTCGATCAGCAAAGCGCTTGTGTTCGTTCGCCTTGAAAAAAT
          ACATAAAATTTCGTATTGGTCATACAGTAAGAAGACAATTGGAAAATTCAAATGCACAAAAGCCGTGAATCGTAAAGACT
          GACAATGAAAAAAACGCTAAGAAAGATAAAATTAAATTTAAAAAATGGCAAAATAAATAAAATGAACCTAACAAATACAA
          ACAAGATTTCACTCCTACAAGTCAAAGAAAATAAAGTGTAAAGTGAATGTGCGGTCAACACTCATCTTTTAAAATACTAT
          TAAAGCAATTACTGTAGTTATATGACCAATGATCGAATAACCAAAATCTAACCGAATACACGCAGCATTGTGGCGCAACA
          AGAAATTTAAAAGCACTGAATTAGTTTAAATCTGTATACATACTCGTATATGTATGAGGAATATATATAAATATATATAT
          TATATATATATATTATATTATATATTATTATATATATTATATATTATATATTATATATTATATATTATATATTATATATG
          TATATATATATATATATATAATATATATAGTTTGGACTACGACTAAACCGTTTAGGGTTCTAGGCAAGAACACTTTATTT
          CTTACATCAATTTAAAGTTGTGCAAGGTATTTAAAGGAGCTAGAAACGGGCAATAAAATGAGATATTTTTTTTATCTCAT
          GTAAATTATTAATCGAACATCTGCCACGCCCCAGAGTGCAACACAGGAAAATCAAGTTGAGATTATAAAAAAATTCTTAA
          AACTGATACGTATAGAATTTCCAAAAACTGAAACAGAATGAAGTTAAACCCTCCACATTTTAACGAATGTTTGATAATAA
          AAACAAGATCGAGAGTAATTTAATACATAAAAACTTTAAACTTATAAAATGCTCAAGACGATTTTACCAGAGAAAGCTTT
          TCTCAAATTTTGAGCAAAAATGAAGTTGAGTGGTTGGAAAGGAAAATTGCAATATGTAAACGTTTACTAGTCATTAAATA
          TAAAAAATGAACCATAAAAAATGTATAAGAAAGATAACATATTTTTTATTAACACTCAGTGGATGCCAAAAACATAAATA
          TTGGAATCATTTTATCAGCGGGAGCTGTGGCACTCAAAAACAAGATAAAATTATTATTAACGAATTGTATTACAGTTACA
          GCTATTACATCCAAAATGCTTTTAAGTCGTTGAAGGCAGTTGTTTTCAGGGTATGGCCATGGATTCAGAAGCGTTAAAAA
          GATTTTTATGGGACCGCTTTTTTTATCGCGAAACAAATTACAATCATGTTCTACCGAATTTATCAAAACAAATTAATGTT
          ATCAGCGACTTAAAAGTATTTTTTATTTATTCCGTTCAATGAACTAGTGTTATTTGATATAGGAAGTTAATAATTTTTAT
          AATTAACTATTAAGTTACATATACATATTTGTAAAATTAATTAATTTACCATTATGATATATATTTTTTAGAAAAGTAGC
          ACAAAAGAAATAAAAATGACTAAAAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0085915
          5390
          FBtr0085914
          5543
          FBtr0085917
          3912
          FBtr0085918
          5246
          FBtr0100618
          4707
          FBtr0332967
          5213
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0293424
          1111
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0085269
          1111
          FBpp0085268
          1100
          FBpp0085271
          710
          FBpp0085272
          1111
          FBpp0100078
          975
          FBpp0305183
          1100
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG2225-RG
          Secondary FlyBase IDs
            References (0)