Open Close
General Information
Symbol
Dmel\Rim-RK
Species
D. melanogaster
Annotation Symbol
CG33547-RK
FlyBase ID
FBtr0305021
Feature type
Associated gene
Evidence Rank
Length (nt)
11676
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 7 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GTTGTCGTGCCGTCGTGATGTCGTTGCCGTCGTCGCATCCGTCGTCGTTGTCGTTGTTGTTGTCGCCGCACTCCATCTAG
        TTGTTGTTGGTGCAGCAGGCAGTACAGCAACAGCAACAAAATCACACACCAGCAGAAAGCAGCAACATCAGGCTTTAAGC
        GCCAGCGAACAACAATTAAACAAGCGAAAATTGCAGCAACAAAAAAAACGAAATGAGCTCGCTAAACGGAAAATTCATTT
        GCGCATATGGAATGCTGCACACATAGTTATATACATATATATATATAGCCACACATACAAGCATATATATATAGATATAT
        ACGTATATGTTATACACACACAAATCTACATAAAATCTAAGTGCAAACCAATTGTGATTTAAGCTAATGACCACAAACGC
        AAAACAGCTCCAACAACCTACAAGAAAGTGTATAAAAAATTTTTCAAGTTTTTTAAGTATATGAAATTCAACCAAAGCCT
        TGTAAATAGCCAACAAAATACCTAAAGAACAAGAACGCTTTTATTATTAAAAACAAAACAACAACAGCAAATAAAACCAA
        ATTAATTAACTCAACTAAGGAAAGCCATAAACAACAAACAACGAACGAATAGACAACGCCGTTTACACAGCAACCTGATA
        GAGAAATGCATTGCTAAACAGCTGTGGGCTACTAACTCCCTTTCAACCGAGTGGCCTGCAATTCGAAACGATCTCAACGC
        AAAAATGGCACTGCAACGCACTGGGCAGCAACAGCAACAAAGGACGAAACTAACTCGACACGGGCTGCAGCAACAACAAC
        AACAACAGCAATTAGAAACAACAACTAAGGCCCGGCAACGATATAGAGCGTTGGGAAAATGAAACAAAAACCAGAAACGA
        GTTTTCCACTCAAATTTGCATTCAGCCAAAGAAATACAAAGGTCTAAGGAAGGAGGAAGGAACCGACACAAACCAACAAA
        CCAACAAACAAACGCAGCACAATAAGAAAGTCGCCAGTGAAAAGGGGTCAGAGGGCATACACACGCACACAGACACACAC
        AAAAGACTCGGAAGAAAGAAAAAAAACAACACAGGAGCAGACCGCAACACAAATACAAGCATAAGGAGCGCATAAAACAC
        AAAACACATTCAACACACGGACACAGAAGGACGAAGAGTGCATTGTGAACAATTTTCAACGAATTTCCAAAAGTCTACAA
        AGTAAAATAACTAACAAGCGTTCATTACGAATAACAAAGGAAACCATAATATTTGAAATTTGCTCTGTGATTTTCTATCG
        GAAATGGTTTAGTAATCCAAATAATAATAATAATAATAGTACTATTTAATAACAACGTATTTATAAATACTGCAAAACTG
        CATTCCAAGCAACCAAACCATAGAAAAGTTTATCAAATCCCCCAAGAAAAGCTTTAAACTCAATCGAAAACGTAAATCAA
        CAATTTCTATAAATATTATCAAGCAAAGTTTATTACACTGCGACTAATTAGACCAGCTAACGTTACTCGAAAACATACTT
        CGACCACAACCACAATTCCACCAAAGGACATCGCCACACCGGAGCCATGGACGAAATGCCCGACCTGTCGCACCTCACGC
        CCCACGAGCGGATGCAGATCGAGAATGTCCTTATGCGACAAAAGCAGGAGGAGGAGAAGCAGAATGAGATCATGCGGCGC
        AAACAGGACGAGGTGGTGACGCTGGAAATGCAAATCAGACAGCGATCCGAGCAGCAGAAAAAGGCCGGCGTCGAGCTGGA
        TGCCACCTGTCACATATGCCTTAAGACCAAGTTCGCCGATGGAGTGGGCCACATCTGCCACTACTGCAACATACGCTGCT
        GCGCCCGGTGCGGCGGCAAGGTGACGCTTCGCAGCAACAAGGTCATTTGGGTGTGCATACTGTGTCGCAAGAAGCAGGAG
        CTGCTCTCCAAGACTGGCCAGTGGATCAACAAGACGGCGGCACAACAAGATGGTTTCATCCGACGCATCGAGCCGGATGG
        GAGCAGCGACATCTCGCAGCATCCCATCGTGGATCCGCACGACACCACGGATAAGCGGCCTAAGCTGGAGAGGACGCGGA
        GTGCCGCCGAGAAGGAGAACCTACCGATGCAGCGGGCGGGCAGCATGCTGAGGCGTCAGTACTCGCAGCAGGAGCAGCCC
        ACGAATCGTCGCCTCTCCGCGTCCGACAGTGGAATGGATCCCGTTATGAGTCCTGGCCAGCAGATGCAGCACCATCAGCA
        GCAGCAGCGAGCTCGGATGCAGCCGATGAATCCGCAGCAGGCACAGCAGGGATACGGCATGCAGCAGCAGCAACAGCCCA
        GATCAGGTGGCGCCTATCCCGATGATGACCCCAGATACTATCAGGGTGAACTCGATGGCCTGATGAGGCAGCATCCCCAC
        TTGGCGCATCCCAGTCAGGTACAGCCGCAGCATACGCCGCAGTCGCATTCGCAACAGCAGCAATCTCAGCACCAGCAGCA
        ACATCTTATGCCGCAACAACATCGCCCATCGCCGCAGCAACATTCCCAGCAGCAGCAGCAGCAGCAACAACACTCGCAGC
        AATTTGCGGCCAGGCAGCAGCAGCATCAGCAGCAACAGCATCAGCAGCAGGTGCAGCAATCGTACCACGCCCAGATCCAC
        CAGCAGCCGCAGCAACATCCGCATCCCCACTCGCAGCAGCAGCAGCACCATCAGCAGATGCAACATCAGCATGGCCAGTC
        AGTGCCGCAGATGGGCGGCTACCAGAAGCCACCACCTCTGACTCGCAACCTGACCATCAGCGGTGGTCATGCGATGGACT
        CCAGTGCCTACAGCCAGCAACAGCAGCAGCAGCAGAGGCGCGCTCTCGCAGGATCGCAGTACGCCTCGCAGCAACAGAGA
        TCATTCAGCAGCTCCGAGGAGGAGTTCCAGCACCAGCTGTTGGCCGCCCAGGGCGCGGTGACGGTGACCGCGGGATCGGA
        CTATGACGGCGGGCGCCTCCAGGTGCGCACCTCATTGGATCCGTGGCGCCAGCAGCGCAGCCTCAACGAACGGGATCTGC
        TCAGCAGCGGCGGTGGTGGTGGTGGTGGTGTCGGTGGTGCTGACTTCCGCCACCTGTCGCACGCCACCCAGCGGCTGTAC
        GCCTCCGCCGATCAGCGGGATCGCTACGAGCTGCAGCTGCAGCACCGCGAGCGCCTGGAGCAGTATCCTCTCACGCGCAC
        CGCTCGCCTGGACGTCCAGCAGCGCAACTCGCTGAACCGCAGCAACCACGAGCGGCAGTTCTCCGGCGGCGGAGCAGGCG
        TAGGGCCAGGAGGAGCGGGTGGTGGTGGTGCTGCTGGCGCTTACCGACGTGCCCCGCCCTTGGCAGCCGCCGGCGGCGGT
        GGCAGCAGCAGCAGCAGCACCACTAGCAGCAGCTACTATCCCCAATCGAAGCCGCAGATTGTGATTGGTCCGGGATCGGG
        CTACGATCGGGGATCGGGATCCATGGCTTCCATGGCATCGGCAGCGGCGGCAACAGCGGCGGATGCCCAGGGTCAGGCGG
        CGCGGAATAGCCAGCGTGGTGGTCTGCTGGGCGCCACGAGAGGCGGCGGTGGCAGCAGTTCCGTCAGTTCCACGGAGGCT
        GCCTACTGGGACGAACCGGCCACCAGTTCCTCCTCATCGGCGGCACAAGATTCGCGACGATTCACCGAGCGCAGAATAAA
        GAAGACGGTGCGTTTCGATGCCCACGACGAAGAGGCCTCCATATTGGCCAGCAGTTCACTGCCCCCAGTCACGGCAATCC
        TGCCCTCTACGGCTGTGGATGTGGGTGCAGCCACCATATTGAGCAGTGGAAAGAGCCTGGATGCCGTCGGAGTTGGTGGA
        GCTGACTGGTCGCGATGGGAAGCCGAGCGACAGGGTAGCCAGGACTCGGCCACCAAGGACTCGGGCATCGATACCAGCAG
        CACGTTCACCAGCAGCGAGGACTCGAATCGAGGAGATGGGCCCAAGAATCCGGTGAATTGGCAAACATCCGCGGACAATA
        CTCGCCTGATCGGGCATATGATATTGCGTAAATACTATGATGGGGAGGATATATTAGGCTTAAAGGTCAACGGCGGTCAG
        CCCCTCGCAACGGGTGGATCGGTATCGGGAGCGGGAACGGGAGCAGCTATAGGAGCAGGAGGTCCATGCGGGGCCATTGT
        GGAGAAGGTGAAGCGCGGATCGGTGGCCGATCTCGAGGGAAGGATTCGACCAGGTGACGAGATCCTCGAGTGGAATGGCC
        GCGGCCTGCACAACAAGAGTGCCGACGAGGTCTACGACATCATCGACGAGAGTCGCCTGGACGCCCAGGTGGAACTGATT
        GTCAGCCGGCCGATCGGCAGCGGCGGCGGCAGTGGCGGCAGCAGTGCCAACGTCAGTCCCATAAGCGGAGCCTCCGGCGG
        ATCCGCCAACAGTGTGCCCGCTCGCCGCTCCTCGGCCAACTTCCCGCACAGCGGGTTGGCGAGCAGCATGGCCGGCAGTG
        CGGTGGTCAGCAGCGGGGGAAGATATCTGCAGCGCAAAGCTCCCGCGGTCGAGGCCATTGAAATCCATCGGGACAAGCCG
        AGCGTGCTAATCACCTCGCCCGGCTCGCCGGACATCCACACCAGTGTTTCCGGACCGGGATCGGTATCAGGATCAGGACT
        CCGGCAACGTGGCGGCGTCGGGCAGACGCAACGCCTGGGACCAAGTCACAGCACCCATAGCCATAGCAGCAGCGGGAGTG
        GCAGCGGCAGCGGCAGCAGCACCAGCAGCGTCCACGCCCCCGCCTCCGCCCACGGCCCCGTCCACGCGTCGGCGTCCGCT
        TCCGGTTCCGCCCCTGGCGGCCTGCACGGCACAACGACGGCGGGCCACCATCACCACCCGCACCCGCACCACTACCACCC
        GCACCAGCATCCGCTTCCGCATCCGCACCAGCATCAGGGTCCGCCCGCCGCCCACCTGCAAGGCCACGGGGTGGGCGGTG
        GCATCGGCATGGGCAGCGGCTCCGGCACCACCACACAGCCCATCCCCATCGAGGGACGGCTGCAGCTGAAGCTTGGCTAC
        GACCAGAACACCCTGCAGCTGATCGTGACCCTGGTCTGCGCCACCGGACTCTCCCTGCGCCAGAGCGGAGCGGGCCGCAA
        TCCATATGCAAAAGTGTTCCTTCTGCCCGATCGAAGCCACAAATCCAAGCGGCGAACGAAGACGGTGGGCACCACCTGCG
        AACCCCGATGGGGCCAGACCTTTGTCTACTCGGGTCTGAGGCGCTGCGATCTCAACGGCCGACTGCTCGAGGTGACGCTG
        TGGGACTATGTGCGGTACGGGGCCAACGACTTCATCGGCGAGGTGGTCATCGATCTGGCGCACCACATCCTGGACGACGA
        GGCCGAGTGGTATCAGCTGCAGCCCCACCAGGACACCTCCTATCTCTTACGTGACGAGGGCAGCGATGTGGACGGCCTGA
        TACTGACACCGACAGATCATTTATCACCGCCGAGCACCATGTCGCGCCTTAGTGATTCGGACACCACGTCCGACTGCGAC
        ATCGATGGAATGACTCCGGGGGCCAGCATCTCGTCCATGGGCAGCTCAGCGAGTCCGCCGCCCCTGCTAGAGCTCGATCT
        AAACGAGCGTCGGTCCCGACGTGACATGTCGCCCCAGGGCCGCAAACGGGTGGCCGGGATGGTGGCCCGCGACTACCGCA
        CTGTATCTGGCATTGGACAAAGTTACCACAATCAGGCCTCTGCCACCGGCTACTATCGTCGCGGAGGTGGTAATGGTGTC
        GGCTCCGCCATCGGTCCCGGTGGCATGAGCCTCAGCCAGCGGAGTCACTCGGCGGCACCCAGCGACGGTTACCACAGCAG
        CGGAGTAGGAGGAGCGGCCTCCGGCGGACCCGCCTACGGCTATCGGAGCACCAGTCCCAGACGGGGCTCCTTGTCGCCAC
        CCGACGACCGCTACATAGACTATCCAGTGCTTCCAGTACACGGCTCCTCGCCTAACGCCCCATCGGTCTACCAGGGACCG
        GGTGGTGTGTCCTCAGCGGCGGCATCTGCCTCGCAGCAACAGCGATTCCAGTCGCGATCGGCCACAGCCACGCCCACGGG
        ATCTCCAAAGAAGAGGCAGCTACCACAGGTGCCGCAGACCTCACGCAGTGCGATGCTGCGAGATCGACTGGGTCAGGACT
        TCGACGAGCGGCTGGCCTCGGGTGGTCGCTTCGGGCGGCACCGCACACGGCAGCCGCACCACCAGGCCACCTACCGCAGC
        ACCGGAATGGGCGGTTGGGAGCGCCACTACACGGGTCTGTCGGACAGCGACCTGCACTCTATGGACGCACGGATGCGACC
        AAGGCACTCGTTATCGCCGGACAAGGACTTTATGGGCGAGTTCGGCGACTCGGACATGGAGTCGGTGGTCAGCGTGACCT
        CCAGCGCCTTCTCCACGCAGTCGGAGCGACCGCGCACGTCGCGCGGACTCAGCTTCCCCCGCAACTGGCGCAATCTCTTT
        GGCGTCCGCAACAGCTTCCTCGGAGGAGCAGGAGGCGAACCCATTACCGGACTGCGGCTGCACCACTCGGAGCCCGGAAG
        GGCCAATACCATCGAGGTGGATGACTGCGACTATCTGCCGGTTGGCGGTGCCCAGCAGTTGGTGTTGCTGGAGCAGCTGG
        AGCAACTGCAGCAGCTGGCCGCTCTTGCGGCAGCAGATTCCCCACCCATTTCGGCGGGAATTGGAATACAGCCACCTCAC
        CAAGTTTTGGTTACCGATGCCAATAGCGGCCAATTGGTGGAACAATTCTACGTTGAGCCCGGCACAATGGCCGAGGAGAT
        GATGGAGCCACTCGATCCCCATTTACATCCACATTCCGTCTTCTACTCGCCATCGCCCCATTTGCCACCACAGCCATTCG
        ACATCGATATCGATACCATATATCCACCACGACGGTCCAACGGACTGAAACCGAACGTACAAGCCACCGCCGCTGCCTAT
        CCGCTGCCGCTGCTGCCGAGCTTTGAGCAATTCAAGCGCATTACCACGCCCATCACGAATTTCTTCCGCAGCTCCTCGCC
        CGCGGGCGTCCATCCACACGCCCACGACCACACCTCCACGACGCCCAGTTCGCTGGTGGGCTATGTACGTGACCACCAGG
        ACAAGAGCTGCAGCCACTGCCAGAATGGAAGTCAGCCGGTGGTGCTATCGACGCACCACACCCTTCACCTGACCGCCGCC
        GGTCTGGCAATCGGCGCTTGCCAGGATCCGTGCTGTCTGGCGGATGCCCATCCGCACCCACAGCATCAGCCGATGGGCTA
        TGGGGAGCCACCCTCTTCGGATCCTGCGATGTGCGGCGAGTGTGTGGATCAGCACTTCCTGGGTGGATTAACGGGACCGC
        AACTGAATCTTGGTGTGGTTCCCACTTACCATGTTCACACGCCCACTCCAAATGCCCATCGGCGTGCCAGGGGACAAATG
        GCAACTCCTGCACCTCCGCCCACGCAATCAGTGCTACGCCTTTCGCGCCAATTGAGCGAAGATGCCCTCGTGGCAGCCGT
        TCCCATTTCGGAGGCCAAGGCGCAACCAACTTCGATCCTGAAGAAACCGAAGCTGGAGCGAAGGCGACTCTTTCACGAAG
        GACAATCGCGGTCGCTAGACTACGATGATCTGCACACGAAGAGCTGGGGTCGACGTCGAATTCGGTACGAGGACGAGGTG
        ATGCCTTCGTCTGGAGACTATCCGTATCCCCATTCGAATCCGTATTCCAGCTACTCACCCACGGCGGCAATGTCGCGACG
        CTACGGATCGGAGACCAATATTCGACAAAGTTATATGGGTGCAAATGTGGATGCCAATCATCCGCTGAGCCACTCGCATT
        TCCTGGTAACGGATGACAAGATAGTGACCATTACCTACGACTCGGATGTGGGCTGGACGCGACGGGGCGTGGCTCCGTCC
        CTCTTTCGCGGAGCGCACCGACAACGTGGACTGGCGGATCCCAGGAATCACATGTCGCTGGATTTGCAGCGAACCAGCCA
        ACAAAAATTGTACGGACCGGCGGCACCGTATTTGAAGCGCCGAAGGAATCTGCCGCATCCGCCCAGTGCGCAGAATGCCC
        ATAACTTTTCACCAATGGAGCCGGGATCGGGAATGGATGGGCTAAATGCTGCGGCAGCGGGAATGGTGGAACAGGGCAAC
        GGAATGGGTAGCGGTGGTGCACACAACACTACCAGTACACACAATAGCAACCACCACAATAGCCAAGCGAGTAGTGTTAG
        TGTTAGCCAAAGTCACAATCAACAACTTCAACAACAACAACAATTACAACAACAATCAGTTAGGCAAAAAGGGAAAGAAG
        GCACCACCGCCATTAGCGGATCGATGATGGCATCGGAGCAGCTGACGAAATCTAGTAGTGGGAGCGGTGGTGCAACATCT
        GCTGCCGCTGCTGGGCATCTTGTCGTCGGTGGTACTAATGCTAATAATGCTTCTTCTTCCTCTTTTGCAAATCCCCAACC
        ACCACCACCACAACAACAACAACAACTTCATGGATCACCCAACAATCTCAACAACAATAACAAACGTGCCCCATCATCAA
        CACCACAACAAAACACGAACACCATAAATGACGCCAACAACCTGACGCTCGACGCCACACAACAACAATCACAACAACAA
        CAACTACAACAACCACCAAATACATGCACAAATCAAAACACGAATCCAACAACCACATTAACAACAACAACCACAACATC
        GTCGAATGCAACGAATGCTGCGACAACGACAACCGCAAATGCAACAAATGCTACAACAACTGCCACAAATCCAACAACAA
        CAACAACGAATAACACGAACGAACCAAACGCAACAACAACAACCACAACAACGAACGCTAATGCTGACGCGGATGCTGAC
        GCGGACGCTGATGCTCCGCTGGACGCCATCGACTGGGATGCCATCGATGCTATGCTGGACGACGACTTTAGCGAGTACGA
        CAAGGACAAGAACGGCGCCGAAGAGGCTGGTGGCTCCAAGTCAGCGGAGGGTGCAGGTGCCGAAGATAAAGTCGATGGCA
        GCCTCTCGGACACCGCGAACGATCGGAAGAAGGGCGGCGGCGTCGACCAGGAGCGATCCCCGAAAGGAGGCAGCGGCATG
        GGCAAGAAATCGAACTCCACGTCGCAGCTTTCGGCCACAGGTCGTAAAAGACGTATGGGCTTTGGAAAGAAGGGTAAGAA
        CTCGTTCACGGTGCACCGCAGCGAAGAAGTGCTGCCCGGCGATATAACGCGGGAACTGCGAACCGGTGGCGGATTGGGCG
        TCAGTCTCGGCGGTGCCGGTGGTGCCGCCGGTGGGTCAGGTGGTGCCGGCGGGGGCGGCCTGTCCCGCGGCTCGTCCTCG
        GAGGTGGACGCCATCGAGCAGTTCTTCGGCGATGGTGCCGGCGGGGAAAGATTCTCCCCTTCGTTGCGCAACGATGGAGC
        CCTCAATGAGTTCGTGGATGGCCTGGGCCCTGGTCAACTGGTTGGTCGCCAGGTGCTGGGAGCTCCCTCGCTGGGCGACA
        TCCAGCTATCGCTGTGCCACCAAAAAGGCTGTCTGGAGGTGGAGGTCATACGGGCCAGGGGCTTACAGCAAAAAGCCCAA
        TCAAAAATGTTGCCTGCTCCATATGTTAAGGTGTACCTAGTGTCGGGAAAGCGCTGTGTGGACAAGATGAAAACTTCCTC
        GGCTCGACGCACCCTGGATCCACTGTATCAGCAGCAGTTGGTATTCAAGCAGTCCTACACCGGTTGCATACTACAGATTA
        CCGTGTGGGGCGACTATGGCCGCATCGAGAAGAAGGTGTTTATGGGCGTGGCGCAGATAATGCTCGACGATCTGAATCTG
        TCGAATATCGTGATCGGCTGGTACAAGCTCTTTGGCACCACCTCACTGGTCAGTTGTCCCACTAATATAGGCTTAGGCTC
        TAGGCGCTCATCCATAGCCTCACTCGACTCACTCAAACTCTAGATCTAAACTAAACTAAACTGAAACTCGACTAAAAACC
        AGATTATTTCAAACTCAAATCGTACAAGATTACAAAAACAAAAGTATAATAGAAATTTCGCAAATCGCAAATTTGATAAA
        CAAATAACACTTGCATATATTTATATAAGTCAACACACAGAACATATATTTATATAGTATTTAGCTCAACGTTTTGTTCA
        TAGCAAGTTACAAAGAACAAAAGTTGTTTAGCTTTGTAGTGTAATCAGTCTTAAAACACCTGTAAAAAGAAATCCCCAGC
        TCAAAAGATCAGTTCAAAGGTCCAGCCAACCAATTTGAAATTAAACCGATACAATACTGAACATCAAAGCATTTGTTGTT
        TTTTGTTAGCAATATACAATATACATACGCACTCCTGTAAATGAAAAGCTTATTAAACTCACGGAAACTCACAAGAACAC
        TACTCCCATGAGGCAAAGTAGAATGAACCAATTCGCATTGTGTACTAAAACTGAAACATTGAATGGAGAGTTGATCGAAA
        GCAAACCAAATCAAAAATACCAAACTGCAATACCAAATTAATACGAAAATAACCTTTCGCAAGTCACCATAAATCACCGT
        TACCGTTAAAGTTACCGTTACTTCAACGTAGTTTTCACATAGACTCGTATAATACTCATATAGGTATGTTTCTCTATCCC
        CAACTACCCAATCAAAATCAATTTACTAGAACCGAACCGAACACTAAACTGTTTTGCTTAGCATTTTCCTAGTGCATGCG
        TAACTAAGTATCCAGTTGATCCATTTTGAATCATTATTATTTACGATCCACACTACGTATGCGTAATATTTTGCTTTCAA
        TTGCTCTAACACCACAATTTGACTTAGCTTTGGTATAACACACCCACAATAACTACATTTCGAAACATAAAATGGCAAAT
        TCTGGCTAGGTAACCAACATACATACATAATATAGCAATTTTCTAGGCCTAGCTCTTTTGTTAACCTATTGCAATGATAA
        AGGAAATACCAGTGTTGTTACCAACCAATTTTAAAACCACACCCCAGGGTCGTCCGATTGTTTGGGCTGGCGAATCAGTC
        ATTATGGAGGAGCCCGGCGAATAACAGTTTCCAACACTATCGACACCCAAACAAACAGCCAACACAACGAAAACACTTTA
        AGCACCCAAGCACAATTCAATTCAAGCGAACCTTAAACTGAACTGAATTCATAACCATTCGCCAGTGCTGTCAGCCCGGC
        AGCCAAATAGCAAAGGACCAAAGGACATCCTGCAGCGGCGGATTCCAGAGGAGGCCGCCCGATCCTCATTCGGCATGTCG
        CTGGCCTAAGCTAAGTCCACATCTGTTGTTTTTCTATTCTACGGCGGCGAAAGACTTTGGAGTAATACAAAATATAAAAC
        AAAGAGAAATATCTAATTTTTATAAGTCATGAAAACAAATGCATTTAAAAGAACCGAGAAACGAGAACACAAGAGCAGAG
        CAGTGCAGTAAAATGTTTAAAGACGTAACTACGGAATACAGCTAAATGATAAATGTAAAGGCAGTCTATATATACATATA
        CACATATATAACGGATAACATTTGACAAAAGGATACTTGTAAATTATGCATATTTAAAATAATTTTTATTACACACCTAA
        GATCACTATTATTTTCGTAATACGATTACTACGATTATTATTACTTAAACTATTACTGATAAAAGCATAAAAAACC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0336723
        6145
        FBtr0305016
        11128
        FBtr0308498
        10557
        FBtr0336713
        7864
        FBtr0336714
        10187
        FBtr0336715
        6268
        FBtr0336716
        6964
        FBtr0336717
        10892
        FBtr0336718
        8629
        FBtr0336719
        10519
        FBtr0336720
        8599
        FBtr0336721
        6934
        FBtr0336722
        7699
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0293558
        2798
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0307704
        1358
        FBpp0293553
        2798
        FBpp0300750
        2792
        FBpp0307694
        1931
        FBpp0307695
        1941
        FBpp0307696
        1399
        FBpp0307697
        1631
        FBpp0307698
        1955
        FBpp0307699
        1965
        FBpp0307700
        2595
        FBpp0307701
        1955
        FBpp0307702
        1621
        FBpp0307703
        1655
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Rim-RK
        Secondary FlyBase IDs
          References (0)