Open Close
General Information
Symbol
Dmel\SKIP-RG
Species
D. melanogaster
Annotation Symbol
CG31163-RG
FlyBase ID
FBtr0305037
Feature type
Associated gene
Evidence Rank
Length (nt)
6489
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 72 )
Sequence
GGTCAGTCGTCGAAATGTTCGAGATCCGGTCGTTTTGAAAACCAGCTCGAGCGGTCTATTCGCGTGAAATTGAAACTGAA
AAAGCCGGTAAAACTGAAGCAAGTGTGTTGTGATTGAGAATTGAGCGAAACGAAAACGGTGGCCAAACGAGCCGTTTAAT
AAGCAAACAGGCTGGCCAATAACCAATTACCATCAGCCATGCCATCAAGGAATCGTGATAACGCAGACACAACCGGCAGC
AATTTGTTAATTTGAAACGTCGTGTGTGTTCCTCTACGAAAAAAAAAACCCAGTTATTTAGCAAGCATTTAAATTGCATT
TGTAGCATAGCACTTTAGTTGCGCGTAGGAGGAACAGCAAGGTCGTTGGGGTCGAATGTGAATGTTTGTGATGCAAGTGA
CAAAATCAAAATTGGAGTAAATTGGTAGCCATTCCTGTGAGCATTTTCGCGTCGCGTAACGGTAAATCATTGCGCCCTGC
GTGTCTTCGTGTGCGTGCGTGTTTGAGTGTACGTTTTTCGGTTTTGTTTTCATCTCCTCCTTGCCATCCTCCTTTCTTCC
ACCTTCAATTGCCATCTCCTAATTTCCTCTACGAACGGAGAAACACGAAAACGAAAAGTTTCGAAGACCAAAATATTGAT
GAACTATATTTTTGTACTTGACAAATTTTGAATTCAAAACAGACACTAGCGCACAAAAGAACCTGTCATTTAGAACATAA
GAGGAGCAATGCGGCGAAGCGGTGGCGCCAAACAAAATGTGAGGATAAACCAGCGTTGGAGCCTTCTGGGATTATGCTAA
AAATGCTCAAAGTGCAATATAAATTTTTATGAGTGTACGCGCTGAATTTTTACGACTGTCTGGGGGCGGGGAAAATAAAT
TAGAGAAAATGCCACAGGGAGGACGATTTAAAACAATACAATAGCTTAAAGTGGCAAACGGAAATTGCATGCAACCAGGA
GGCGTGGCACTGTACGCCCCCCGAGCACGTGACGCGCACACCAAGCCAACAGCGAAACTAATATAAGCCATTTTGTAGCG
CTAATTCGCAGGACACACGTAAACGCAGCACAGCTACGTCTTACGTAAAAACACCACCCATCTGACACTTGGAAATCAAG
CAGAAACCATACACTCACCTCATCATCATCATCATCAACATGGCCGTTAGCAATATTGTCTGCGAGTGGCTAAGAGCTTT
GGGCCTGGCCCAATACGCCGAGAGCTTCCTGGACAATGGCTACGACGACCTGGAGATCTGTAAACAGGTCGGTGATCCCG
ATCTAGATGCCATCGGCGTCGAGAATCCTGCCCATAGACACAAGCTGCTCAAGAGCATCCGATCGCTGAGGGAAAAGGGC
GCCGCATCCGTTTACTTTATGCTCAACGATCCCAACTCGCTCTCGGGCAGCATGGAGATCCTCTGCGAAACACCACCCAA
CAACGAACTGGAGCTCGTCCTGCGGGAGCAGCTAGAGACGGACGGAGTCCGGCTGACCGCGCATCCATACTCAACACCGG
ATGGACAACGCGGCCATTTAGAGGGCCTGGCATCCGTCTATTGCGAATTGCTAATGGCTCCCTTCGGGGACATTTTGGCA
ACTATCGAGCGGGCGCGCCAGGCGGCCTGGGCGGAGCGGAGTCCGCTGCACAGTGCCGCCCAGGTGGTGGGCGGATCAGG
TGGGGCTGGCGGCAGCACGGGCAGCGGCAGCGGTGGGGCGGCCAGCGGTGGCAGCGGCGGCAGCAGCGGCGTACTGCACC
ACCGCCAGCAGCATGGCCATCGTGGCCATTCGATGCACGGCGCCGGTCTGCCCAATAGTCATAGCCAGCCCATTTATGTG
CCCGGAAAGTACTCGCCCTCGAGTTGTCTGTCCGACAAGGAGGAGGATGAGATTTACGGATTCGGCTATGGCGTCTTCGC
ACCCCGCGTGGCCAGAGGAGGGTTAACACAACAGCAACAGCTGCTGCAGCAGCAGACGCTGCAAACGCAACAGAGCATAC
AGCAACAGCAGCAGCAGATGCAACAGCAGCAGCAACAGTTACCAATTGTGCCAGGACAACAGCAGCAAGGACCTCATCAG
CATCAGACCCTGCCACCGAATGTCGCGCATTTGAACTTTGTGCAGCAAAACTGCCTGAGTCCGCGCTCAGCTTATTTCTA
CGAATTTCCACCGACAGCTGAGGGCCGCGAGACAAAGAAACGCACCACACTGGCCCGGCTGCTGAAAGGCTTGAAGACTG
TCAATCGACGGGATCGGAACAATCAACAGAATGGCGCCCAGGCCAGGGCGGCTAACGATCGTCTGCGGCACTTTCAAATG
ATAAACGGCGGCGCCGGCGGACAGCAGCACAGTTTCGAGGAGACAATCCACAGGTTGAAAGTACAAGAGGCCATGCGGAA
AAAGGAAAAATTTCAACGTGAACACGAGGAGATCCTGCGTGATATTCGACAGGGACTGTTGCAAATGAGTCGCGGCGAAG
GACGCATGGACGATACGTATATGTACGACGAGGCGCTGAGAACGGGTGGCGGTATGGGCATCGCCGGACTGGGCATGCCA
CTCGGTGTGGGCGGCAATGGTGGCGGCGGGGGAGCAGCCCATTATGCGGGTGGCCGTGTGCGCTTCTCGAACAACCGCGA
GAGCACAGGCGTAATTTCATTAAGATCCGCCGGAGATATTTCATTGCCGCAACGTGGACCGCCGCGTAGAGGTCTTATCG
TGCCGCAGCAGCCGCCAAATCCACCGACAATAATACCCTTAACGCACGCCAGATCTCATGATCGCGAAAGCGGCGACTAC
GCGGGCTCCATCTCAGATCTACAAAGCGTTACCTCCAGATTCAGTACGGTGTCGATTGGCACCAACAACTGCACGGCCCG
CTATCGAACCCTAAGCGGTGGAATTGGGGAATCACCATCGCTGTCGCCCAGTCCATCGTCGGATTACGAGGACATCGGAG
TGACCAGGGGCCACGGATGTCTACCGCCCAGCCTGCTGGCCGCTAAGGCCAAAAAGAACGGACTGCCGCACGGCAAGGCG
AACACCATTTGCCAAAAGGCCACGGTGCATCATTCGGGCGAGATGCGTAGCTCGGCAAAGGAAATTGGCGCATTTAATGA
GAATGGACGAAACTTTGTTGCCACAAAGGATACGTCGAGGGATTTCAGCAATTCCCAAGATAATACCGACCGTGGCAGCA
TGAGCGATCAGGCGTTCGCCTGTTCGGCCAGCTCCGTGGAAAGTTTGCCCAGCGCATCCGGTTCGAGCACCCAGGCTCTG
GTTCGTCCTGGCAGTCCGCACAGCTCGATTTCGGCCGAGGATCGCACCTCGATGGCCAGCTGCATCTGCAAGGCCAAGGC
TCTCGTGGATAGTTTGCCCAATCCCTACGATAAGGAGGCACTCAAATTCAAGAAGGGCGACCTTATCGATGTGCTGTCGA
TGAACGCCTCGGGCATTTGGAAGGGTCGATGCCACGGCCGCGTGGGCCACTTCAAGTTCATCAACGTGGAGGTGCTGCCG
GAGCAGCGAATGAAGAACTCCAGCAGCAAGACCCTGGCCGCCGGCTCGCGTTTGGCTAATTCTGGAAATGGCAGCCACAA
TGGTGGACCCTGCTCCGTGGAGGACCTGCTAATTCGCATTGGACTCAAGGAGTACACCTCCGTCTTTGTGCTCAACGGCT
ACGAGGACCTGGAACTGTTCAAGGAACTGGAGCCCGCTGACCTGGATTACCTGGGCATTCTCAACCAGGAACATCGTGCC
AAGCTGCTGACGGCTGTGCAACTGCTGCATGACATTGAATCTACAAATTTCGCCCGCACAGGCTCCGATGTGGATATACC
CGGATCCAGCTCGGAAAATGATGAAGCCCGCCTGAACAACATCAATATGAAGCATGGAGCATCGCCCTTTGGTCGACGCC
ACTTTCCCCGCGACTCTGGATGCTACGAGGGATCCCCGCTACCCAGCTCACAGACACCTACCCAGGCGGTAAACTCGACG
GACGAGTCGAACAGCTTGGACGACGTGGTGACCAAGTGTTCCAGTGAAATTATGAAGCGCGTGGAGAGCGCCCGCCGTTG
CAAGGACAATCCGTTCAAAACCACTCTGCCCGGCGGAGGACGACTGGGCAAGAAGTCCTTTCTCGGCGGCAACGGCCTTA
TGGCGGACGATACGCTCACGCGTGGAGGGCTTAGCGAGAAGTCGAGCGATTCGGGGGTCAGCAGCAGTTCGCTATCGTCG
GGTCCGCTGAAGAGCAGCACTTAACATTTGCCCACCATACTGGCCCACGAGTTGCTGCTGGGCGTGGGCTCGGGCATGGG
CATGGGTCTTGGTCTTGGCACCATGAGTCATGGCACCACAGGTACCCTGACGCCCCACGGAGTGGCCACTGCCACCTCGC
CTACCGCCCATTCGGCACCGCTGGGTAACATCTGCAACACGCTGCCACATGCACCAAGCTCCTCAGGCGGCGGCGGCGTA
TCTTCCTCCATGGCCAGCAACCTGCCACTCAACCGGAATCTGGTAATGCTGCGCAATCATCTGCGCAAGAATACGGGCGG
TAGCATTACCGGAAATGGCGGCGTAGGAGCTTCCGGTGTTGGAGCACAGCTGCTGCAGGATCAGGACGACAGACTGGAGG
ATCAATAACCCATTTACTACATCAAATTCTTAGTTTAGTCTCCCATTGAGTTAAGTGTATTTCAATTGCTGTGATTCGAT
AGTGAAAACAAAAGGCCAACATGCGTCTTTCAGTTCAAATGTATAGTATGTATAGAGAGAGATAGACAGACAGTTAAGAG
AGAGACCGGTATAGTGGGGGATGTGTTTAAAGGAAAGAGAAAGATAGCAAGCAGAGATAGTAAGAGTCAGTCAATCCTTC
CTCCGATAATGTTGGCATTTACACAAATATTTAACACTTATATAAATACAGACTTTACAGACTTATATATACATACACAA
TCTGCAGAAAAGGAGAAATTTTATATACTTAGTGATGTAATGAAAATATTTATATATTTTGACTATATTTTGATTTTTAG
TTAGTTTGAAGCTATGCATTGAATGAGACTTGTATGATTTGCCATTTTATTACTGTTTAATTGCTTTGTGTATGCATATT
TCTCAACGTGATATTGTCAAACGTCCAACTTGAATTGCATTTTAAATAGATTCATTTCTAACATTTTAATAAGAGACACA
CATAGAAGTTGATTCCTATTTTAAGGCACTAATCTGAGTGCAAGCAATAGACCAATTCAATTTTAGCAACCAAGCAAAAC
AAAATATTTATAAACAAAAATAGAAAACATAAGAAGAAACAGAACACCAACTGCCATTCGAAACTAATTTTAATTTGTTA
ATCTCGTATTAGGACAATGTAAATGGAATGAATGCATCGTGCAAATCCGTCAGAAACTTGTAAAAATTAATGCCGAAAAT
TGCCAAATCGAGCAAACAAAAGTAATGTACGCTAAGCAATATTTTCAAATCGTAGCGTGTCGTGTCCGGATCGTGTGTAC
ATATATAGGATGATCCAGTTAAGATCTATTATGCCACTTATAGCAGATATCAGATCGTAAACACTATGAGCGATTTAGCG
TTAATCAAAAGCAGACAATGAAATTAGTCAGGCAGCGCAAATGTTTTTAATCAGTTTTCAGCAATTAGTTAAATAAATGA
ACGAATATTTATCACGGCACAAGAACTACGAATAAAATATTTAAATTAAATCTGATTAAAATACATAATAATTAATAGCA
TAACTAAGCGTAGAGCATATGATTCTAATATGGCAATTGACAAAATGTAAATGAGTTTATTCGCAAAACGCTTTGACTTT
TACTCAGAACGTAATTAAACCTGAACATATTTTGTGACATAAGATATCGATATTCATATTGTAACTCAATTAATTCTAAT
CGCAAATAAATTAAATCAAATTTAAACAAAAAACAAATCGCACGTGTTACAGCCCGACGAAGATAAGGTTAAAGACATAT
ATATGACAAGAGGATGTGAAATACTGGACTATAGGCATTTTTTTAAATTTAACTCCAAAGTACATATAAGTGTTTCAGCT
GTAAATTGTAACAAAGTCAAAAGAATATTTATATATTTAGAGATGGACGAGAAGCAAACACAAAACGAACACATCCGCAC
AGCATGTGCTAGCATTTTCTAATTATCACTGTAAAATGATGTAATTTAAAGACAGAATATATAAGCAATATTAAAGTTTA
ACCTAACAAGGAGCCACAAAATCGATCATAAGGTCAACACATTACAATTGCAAAACAAAACAAAAGAAAAACCAGTAAAA
TTCCAATACACAAAGTAAAACGAGAGCGCAAACTAAAGTATTCAGAGTTCAGTAAATTTTAGAAGAAATTTTCAAAAATA
AAACCAAAACTCGGTGGATAATGATGATTCATGTTTATGCATCAATCAAAATAAAATTCTTTAAATAAAAATGAACATAT
CTAAAAAGT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0084197
5049
FBtr0301028
5788
FBtr0305036
6584
FBtr0310203
508
FBtr0330381
5049
FBtr0336712
6669
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0293574
1034
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0083595
952
FBpp0290250
1064
FBpp0293573
1064
FBpp0301887
128
FBpp0303407
1080
FBpp0307693
1027
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
SKIP-RG
Secondary FlyBase IDs
    References (0)