Open Close
General Information
Symbol
Dmel\Dab-RE
Species
D. melanogaster
Annotation Symbol
CG9695-RE
FlyBase ID
FBtr0305086
Feature type
Associated gene
Evidence Rank
Length (nt)
7842
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 18 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTTTTCCCAAAAAAGATCAACAATGGCCGAGAGAGCTGCTCGTTTTCTGTACTGTATTTTGCGCCACAAAAATCACTAA
        ATAATAGAGTGAAATCTATGTGTACACACGAGTGCCTCAAAGAGTGTGTGTGTGTGTTTTTGTTTATTATTTCAATTGAA
        CAAACTGCGACAATCCAGTCCAGTCGAAAAAGAGAGTCACCGTGAGAGCATTCGAATCGTTTCCACGCTCTCATTCGCTT
        TTATTCATTCCATGATCGCGCATCGTTCTCCGCTAGAATTTAATTAAATCTATAGCGTCGCGAAAAATCGTTGTGGAATT
        TATGTATTGTTTGTCCCCCATTGTGTGCCCCCTCCAGCACCAACACCCTCTCGTCATCGTCCGCGTCCCAATGGAAATGT
        CAACACACACACACACAACAGAGAGGCCCGGAATGCTACACTGATTCTGTTGACACTTCGGTGACCAGAGTTCCAGAATT
        CCAGAGTTTTTCCAGCCAGCGTTTTCCCAATGAGCAGGAGCAGTACCCACTGAGACTTCGGCCGGGCGAAACATGGTCAA
        GTCCCTGGTGGCCAAGTTGTCCACAGCCTCCTCCAATCTCTCGTTGGCCAGCACCTTTGGCGGCGGCAGCGGCGCGGCAG
        AGGAAACGAATTACGCAAAACATCGCAATGATCCGGGACGCTTTTTCGGCGATGGCGTTCAGTTCAAGGCAAAGCTCATC
        GGCATTCTGGAGGTGGGCGAGGCCCGAGGTGATCGGATGTGCCAGGAGGCGCTGCAAGATCTCAAAATGGCCATCCGGGC
        GGCTGGAGAGCACAAGCAGCGGATAACCATCCATGTGACCATCGATGGTCTGCGGCTGAGGGATGAGAAAACGGGTGACT
        CCCTGTACCATCATCCGGTGCATAAGATCTCCTTCATCGCGCAGGATATGACTGACTCGAGGGCCTTTGGCTATATCTTC
        GGATCGCCGGACAGTGGTCACCGGTTCTTCGGCATCAAGACGGACAAGGCGGCCAGCCAGGTGGTGCTGGCCATGCGCGA
        TCTCTTCCAGGTAGTTTTCGAGCTAAAGAAAAAGGAGATTGAGATGGCGCGCCAGCAGATCCAGGGTAAGTCCCTGCACG
        ACCATTCCAGCCAGCTGGCCTCCCTGTCGTCGCTGAAGTCCTCCGGCCTGGGTGGCATGGGTCTGGGCCACTCGGATTTG
        GCCAGCGGAGGAATCTCATCCGGCCATGCCCTCACCCTGCTGGGCAGTAGTCTTAGCACCACGAATGGAACGAGCAGGCT
        GGGCGTGAGTCTTGACGTGGCCAAGGCATCCGGATCGGCGGCCAAAGAGGTCTCTCCGGAATCCGTGGCCGATCTTGTGG
        ACTTGGAGCAGGAGCTTACCTCGCTTCAGCGGGGAATCAGTCAGATGGAACGGATAACGCCAAACGAGCCGACCACCAGT
        AGCACTGGTGGTGCTGGCCATCCATCTCTAGCGAAATCAGCCAGCGAGGACGATCCTTTCGGAGACTCGTTTATCTATGT
        GCCCTCGTATAGCATACTGCCACCGCCACCTGATTCCGGACGCAACAGGCACAAGCCGCCCAACAAAACACCTGATGCGG
        TGACCAGTTTGGATGCAATGCTTTCGCCACCTCCTGGTACAAGTAGCTCCCACGGCTCAGCCTCCGCTGGACTACAGGCT
        GCAGATAACGACGATGACAACTGGCTGCAGGAACTGGACCAACAAAATGATGTCTTCGACACGTCCAAAGTGGTGAGCAG
        CAGTGGATTGGGTTCGGTTTTGGCCATGGCTCCGCTGGCCTCCAGCGAATCCACGGCCACTCCCACCCAACAACTGACGG
        AGGTTGCTGCAGGATCTGGACCTCTGGCTGATCTGGATATTGGACTAAGTACGGCCTTGGGAAATGAGGAACAGACCTCC
        ACCATTTTGTCATTGGAACCGCCAACGCTGAACTCGCTGGAGAATCCCCATCCGCCGGCGGATCCCGTACTTCTGCCCAG
        GGATACGGATCCGTTCTCGCCCACTCGGAAAAAGAGCGATCCAGATCCCTTCCAGGAAAGCGATCTCTTTGCCAAACTGG
        ATGCTTTCGAGTTCGAGGCTCCGCCGGCGGTTCCAGCTCCCTCGATTCCAAATTTGGCCACGGAGACAAAAGCGAATGTA
        TTCAATGGACCACTTCAGGTGCAATTGCCACCAGAGAAGGAGTTGCAGCTTCAGCAGCCTCCGAGTACGGTGAGGAACCG
        TCCCACAGCATCTGTTTCCGCACTTCCAAGTGGCGGAGCCCTTGATGTGATCTCCAGTATAAGCAACAAGAAGATGCCGC
        ACCTTTTTGGCCAGGCCAGATCATTTGGCAAATCTGGTTCGGATATTGGTTCAAGTGTTAACATGCGCCGCCTGCAGGAG
        AGCGATTCGTTGAGTGAAACAGAGGCAGCTCCCGAGCCACCGCCGCGTCCAGACTCGACTCCGTACTCGGAACCTCCGCC
        CCTGCCACCCAAGAAGCAGTTCAGCGATCTGGTCATCCGACCTTCACCTGCAAATACCACTCAACCGCCAACTAGCGGAA
        GGTATGAGTATTTGAACAGTAATGTCACGGCAAGAAGGACTGCCTCCTCCGTTGACGCACCACCCATTCCATTGCCATCG
        CGCCGTGTTGGTCGCTCTGATGGCTGCTTTCCGGGTCCGGGAAGGCCAAGAAAACCTGGACACACCGAGGATGATTATCT
        AGCTCCGTTGGGAGCTCCACCGCCATTGCTGCCGCCACCCAGCCAAGGATCCTCGGCTCGCGCGAGACCTCAACGGCAGG
        CTTCGCTAGGCAGGCCGCAGGATATCTACGAAAACAAGGCGGAGATTCTGCAGGCTCAAGCACAGGCGCAGGCCCAGGCC
        CCGGAAGTAGCGCCCTCTAGCAATACCTTGGCTCCCGATATCACCCTAACTCAATTGCTCACCCTGGGAATGGATGATTT
        GGCTATCAAACTGAACGTTCCCGCCAGCAAACTGAGCACCATGACTCTGGTCCAGTTGACAGCCTATCTCTCCGAGTATT
        TGTCCAGTGAAAAAAGCCAAGTTCACAGTCAAGAGAGGAGATCTTCGCCAGCAAACACAGCTCCTGCACCAGCTTCCACG
        GCAGCTGTGTTTAAGGTTAATTTTGATCAGCAGACCTCCTTTGTGGCCAAGTTCGACGACACTTTTGGCGAAGACGAACC
        AGTGATGCCTTCGGGTTCTTCGGACTCCACCTTTGTGGCTAACTTCGCCAACTTTAACGATGCACCAACTCCGGTGCCGA
        CAGTATCGCCAGTTGTTGCGACAGTGCCCTCAGCAGATCGGTATGCCGTATTTCGCGAGATCATCGATCAGGAGCTTCAG
        CAGCAACAGCAGGAAACGGATCTTATGGGCGATTTGACACCACCGCCAGTGGATGAGACCCAGGCCAAGGAAATTTCAGA
        GGGCTTGGAGGTGAACAATGTGGGTGCGGAGCTACCAATTGATGCCTTAGATGTCAAACCTGCGCCGAAGATTGACACAA
        AAATCACCGAAGTTGTCGCCCAGGCCAAAGATCGTTACGCAGCTCTGCGGGACATAATCCTAGTGGAGAATCTCTTTGAT
        AAACCAGCAATAGCAACCGACACTCAGCCTGAGAAGGAAAAGGATCTGTTGCAAGACTTTCCTGAGTTCAGTGATGAGTT
        CAACGAGGATCATGACCTTCGCCAAATTATGGATCATCAGAATGTTCAGACTCATGCCCGCGATCGTCATGGCTTGGTCG
        ACAGCAGGGGCTTTCCAACAGAGCCTTCGTCTTCCGCTCTGACCGTGGGCGATTATGATGAGGACGAGGATGCTGATGCG
        GGTGGTGAGAGCAGTCTAGATAGCAATGAAAAGGACGCAGAGCCTGTCAGCGGTCAGGATCAGTATGAAAAGCTATCCAC
        GTCGACGCAACAACTAGATGCAGCTGCTCCGGCTCTAGAGGATGTGCAGCAGCTGCAGCAGCAATCCCTGCCTCCAAAGC
        AGGATCAAAAATTCCTCTCCATCCTAACGGCTCCCGGTGGTGGAACGAAAGATGACATCGAGATCGACGAGCTCATGCAT
        CGTGCAATTTCGAATCTCTCCCTGGACTCAAGGGATCGAGTTTCGCCCGCCACCTCCTCGGCAGCTCCATCACGTGGGGC
        TCCCGGCTTGCACACGCCCTCGCAATTCAATGATGTCAGCACGTCGCCGATTCCCCTCCAGAAACCAGGCATGGGCCCAT
        CGCCTGTGCCGTCGCAGCTTTCGGCCGTGTCCCAACTCATCGATACCGCAACCAAACAAATGATGGGCGACAAGGATCGG
        GAAAAGCAATCCTGGGCTACATTCGATTCCCCGAAGGCAAAAGGCAAGGCTAGGCTAACGCTTCCGCCGCCACCACCTCC
        TGCATCCAACACTTCGCAACCGGATACGGTAGAATCGCCTTGCAGTTCGGATCCCCGGGATGACGGCTGGTCAAAGCAAC
        AGCGTCGTTGGGCGAAGAAGGAGCGCCAGCAGACATCCTCATCATCCCGAGACCTAAGTCCCTGGGACGATGAAACGCCG
        GAGTATCTGAAGCGGCGACAGTTGGCCGCCGCTCAAATGGCTCATCCCCATCAGCCCCCTATGCAAGCTCCACCTCAGCA
        TACGGATCGGCATGGATACTACATGCGACACGCCAGGCGAATGAACTCTTGCGACGAGGACTACGACTACGATGGGGAAT
        TCGTTGCACGCCGAGATCAGCCACAACATCAACAGCAGCAGCGAAAGTTCAAGCACGGACTTTCTCGCAGCAGGGATAAC
        TTTGAATTGGAATCCCCCAGCTGGTATCATCACCCGGCGCACCACACATGGTCGCCTCAGGAGATTGAGCAGGTGCGCGT
        ACGATCTTTCGATCGTACTGCTTACGAGCGATCCAGCTATGGCCCACCGCCACCCATCTACGACAAACGTGGACAACTGA
        GAGGCAAATATCGCGGAGATCACAGGGATAGGGAACGAGAGCGTGATCGCGACCGAGAGTATCGGGATTATGCTCGTCCA
        AGCTACGATTTCGACTACGAAAACGTCTACGAGGAGCGTGGAGGTCGTTCACCGTTGGCCTACAAGCCAGGAAGAGGTGG
        TGGTGATTATCTGTATGACAGAGAAAGGGACAGGGATCGGGAGCGCGATCGAAAATCCTTCGATCGGGAAAGTCTCGAGT
        CCTATGAGAGCGCCACCCGTCGTCGTCGCAGTTTTGGTAGTGGAAACGATGTTTATGGCAGCCTAGATAGTCGCGATGAT
        TACCGTGGCGATAGGGAAAGGGATCGTGAACGTGATCGCGAGCAGATGAAGACCCGTTCATTACGAAAGCCAACAACTAC
        GTCTGGAAAGCTCCGGATAAGTGGCGACATTGATTACGAGCAGGACTCGGAGCAGGACTTCCAGCAGCGATCTGGAGTAC
        GAAGCCTGCAGCGTCCCAATCAGCTAGGCGGTGATGTGGTGCTGCCCTCCAATGCGGTAGTGGGTCCACAGCGATTGCGC
        AAAAGCAGCGGCTCCAGTCCCTGGGACGGAGAGGAACCGGCCTTGCCTGGTCAGAAATCTTGGAAGCGTCCAGCCAGCGC
        TGCTGAAACCGAAAGGCGACTGGCTGAGAGTCGCAGAGCGGTAGCTTTGGGTCAAACTCCCTCCGATGGAGAAAAAGAAC
        GAAGATTCCGCAAGAAAACCCGAGCCCGCAGTGCCAAAGATTTAGCCACCGTCGGTGCTCCCAGCGCTAGTACTTCTGCC
        CCGTCCAGATCGAGCTATGGGCGTGGCATCAGGGATAACTATGACTATATATGTCCAGGCCAGCGTAACGATGACGACGA
        CGATGATGATGAGGACTACGTGGATGATGAACCGCCAACGGATGAGGATAAGTTCGAGAGGTTGAACCGCCGGCGACATG
        AGATGCACCAGCGGATGCTGGAGTCCGAACGTCGGCAAATGGAACGCCATCAGCCGCCATCGCTGGCGAAGCTTCCGGGC
        CAGAATCGTACACGAGGCGTCGTGGCTAACAGTGACTATGGTTTTGTGGACAGTTACGAGCAGACTCCAACTCCCACGCC
        ACGTTCGAATGCCAGTAGCACTGGACCGGGTGGCCTGATGATGAGTGGCGGGGAGTCCTCCGCTGGAGTTACAAGTTCCA
        AGTTCAATTTTGACGATGGATTTGAGTCAGATTTTAATCAGAGCTCTCCGCCGCCGGCGCCAGCAGGTACCGCCTCCAGT
        TGCAATTCCACGCCGGCGGGTCCAGTTTCGGCAAATGCGAACAACGGCGGATCGAAGAGCCTGTTCCGCTTCTCCAATGA
        TTTTTCGGATCGCGAGAAACGGGAGCAGTTTGAGATGGATACACCGCCAACCTCAACACCACCAATTACGCAAAAACTGC
        GATTTGACGATAATGTTAAGGTCTCCCAATTCGATGATGCTGCCTTTGAGGATGACTTCGCCAAGGCATCATTCGATTTT
        GAAAAGGAACAAGCGGGTTCTGCCACAGCAGGTGCCGGAGGATCTGGTGCTATGAGCAGGAAGCAAAATATGCGAACCAG
        CAAGCTGCAGCAGCGCCAGGAGCTCATCAAGAAATCCGAGTCGGTAAACATATTTGCCAAAAAGCAGGAGGATCCCTTCG
        AGGATGACGAGTTCTTTAAATCACCAGACCAGGAACAGGCCATGGATCAGCACAATGATGACACTGAGGGCGGCAAATTT
        CAGTGGAGCGAGGACGCGAACTTTGCAAAGTTCGATGAAAACATGTGATTTGACCAACTGTTTGCCAAGGCATCGGGGCA
        GCGACCGGATCCGGACATCGATAACCACAACTATGCGGAGATCGATGTGGTCAACGACACGGACTTTTCATTTCTGGCCA
        ATCTCAATCACTACTATCAGCAGCAGCGACTGCACAGCCTGCGACAGAGCTTGAATCGCCATGTTTACTGCAACTTGCCA
        GTCCAGCAGTTGCAGGAGCAAGTGAATCAGCCGATGAAGAAATCCATCGCCACATCTACAAGTCCCTGGCATGAGCCAAA
        GGTCAAGTCGAAGCCGCTGCAGCAGCTGCTGAGGAAGCCGAAAAAGTGGAAACTCAAGCGCACCCTAGATGACTTTCTAA
        AGTGTCTGATTATTGCGTCCTCGGAGCATGTGTACGATTATGATGTGCTGTGGTAGGATTGGCGGATTGGGAAGATGAGG
        AGCAGTCTTAGAGAAGAGAGAGAAATAAAGAAACCATACGATATTTAATTCGCCACATATATCTAGTCAACTCAATCGCC
        ATTTAAACTTGCAATATCGTAACACTCCAACGAGGACTGTAGAGTTCCCTCTTACTCCCAGTTCTGCCCAAGCCAAAACA
        TCACACAGCTCTGATCCTATTCCAAAGCCAGATTGTATATATAGATTTATCCAGCAGTCGATTCCAAGCAAGCCATAGAG
        AAAACTTAAACGAGAACAAGTGTTTGTTAAAGCTACTCCCCACTCGTCAAATAACGAAATACTCACGCCCCCGCCCCGAA
        TCATCAATCGATCCGCAAATCGAAAGCAACTAATTAATTGCCTATGCTAGATGTCGTCTATTCCATATATATCGAATTAT
        CCAAAGTGCAACCATTGTGCTAGCATACAATACCACATATATTCCTAGGGTACGTTTATGTTTTTGCATACTACAAGCAT
        AATTTGTATGATTGTTTGATTACATAGTTAACTAACGACTAATTAGTTTAATTCCACGGCAATGTGTTTTTATGATTTGA
        CTATATATTATACATAACTATATATTTATACGTAACTGAACAAGCAACTGAAACTGAACGATCAAGTAACTCCCAAACAG
        CT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0075318
        8461
        FBtr0305084
        7990
        FBtr0305085
        8449
        FBtr0330189
        8301
        FBtr0330190
        8449
        FBtr0333625
        8067
        FBtr0333626
        8076
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0293623
        2071
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0075077
        2224
        FBpp0293621
        2047
        FBpp0293622
        2200
        FBpp0303222
        2360
        FBpp0303223
        2336
        FBpp0305800
        2146
        FBpp0305801
        2149
        Comments

        Transcriptional initiation is supported by short-capped RNA data (FBrf0209722).

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Dab-RE
        Secondary FlyBase IDs
          References (0)