Open Close
General Information
Symbol
Dmel\Asph-RH
Species
D. melanogaster
Annotation Symbol
CG8421-RH
FlyBase ID
FBtr0305090
Feature type
Associated gene
Evidence Rank
Length (nt)
2783
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 5 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CATTTAGTAACGTGCTGTTCGTCGATCCAGATCGCCCGTTTTGCCCGGTCCGCTCGAAAAGGAAAAACAAACACTCTCCA
          TTATATTGGCATAGGTTTTAGTGCCTTTAGCGAGCAAAATGTCGGGCGATGTGCAGCCGCGTAAGCGCAAGGATAAGCGC
          CGAAAACGCGATGATCGCAAGTCCGAGGGCGATGTGACTGTTCTGCGTCAGTCCAGTTTTCAAGATGACGACGAATCTTC
          GCACGGCGTTCACATTACAAAGATGGGAAACGAAGATCTCCACCTGCATGTGCACCACGATCACGGAACTGGCGGTCACT
          GGTGCGCCAAGATTATATTCTTCGCCCTGATGGCAGTGCTCCTCGGTTTGGTGGGTCTGATCATCATGGAGAATCGCGGA
          CTGGAGGATCTGGACACTCCTCTGTCGGAGTCTAGGTTCTCGAAAGTTTTTGATGGCTGGGTGGACGAACATCGAGATGA
          GCATGATGGTCACGATGTGCAGGAACCCTCGGGAGAGGCGTTAGATGATCACGATGAACACGACGACCATGATGATCATG
          AAGACGAAGACGAAGAGCCCCTCACAGAAGAGTTAGAAGAAGAACTGGAGGAAGAGGAAGAGCCAACTGAGGAGGATGAG
          CCAGCGGCAGATGAAGAATATGAGGAGGATGAAGATGAGGAGAACAATGCGGGTGAAAACATAACTGCCGAGGATGCGGA
          GGAGGAGGAAGAGGAGGAGGATAACGATGATGAAGGCACCGTAGAGGCAACTGTAGAAGCTACCACTGAAGCCACTACGG
          AAGCCACTGGCGAATATGAAGCTGAAGAAGATGATGAGGACGAAGCAGCAGCAGATGATGATGCAGTAGAGTCCACTGAA
          GCGCCGCTCTCGAAAGCTGAGGAGCAGGAAGATGATGAGGATGAGGATGAGGAAGAGCAAGAGATCGAAGAATCAGTAGA
          GCCGGAAAGATCCCAATATGCGGCACAAAGTGCTCCCGCCAAAGATAATAATGACGACGACGATGATGATGATCAAGACA
          AAAACGATGCAGATGATGGGGATGACGACGAATTTGAGTCCCTGGCTCAGCAATTCGAAAATGATCCCGAGGATACAGTG
          CCAGCAAAAGCTGTAGAGAGTGAGGAGCAGGATCAAGACCAGGCTGATGAGGAGGAGCCCAAGGAAGAGGGCTCCTCTTG
          GTTGGCATCACAAATAAAGCCGAAAGAAGCTGCACCTGCTCCCGCAGAGAAAGAGGATCCTTTCGAGCAAGAGTTGCGCA
          AGGCAAACGAGGAGATGATTAGGGAGAACTATGCCCAAGCCCTGCGTTCCTTTAACACGCTCACCACCAACTTTGCCCAC
          GAGCCATCGGCCCATTTGGGAAGAGCTCGACTTCTGGAACTACTGGCCAAAAAGGAGCGCAGCAATCAGCGCCTGTGGGA
          AGCCATCGATGCTTACAAAAGATATTTGGCCTTTGGCGAGCTTGTAGCCAGCAATCAGGAATTTCAAACCGCCGGCGAAA
          GCTGCATCGAGAATTTGAGATTTTTGGGTCACCACCGACAGGCAACTACCATCCATGAGCTGCTCATCAATCGTTTGCCT
          GAGGATCCACGGCTTCGTAACCAACTATCACTCACCTATCTTATGGTAAACAATCTTCAGCAGGTTGAAAAGGTGGCTGT
          GGAGACCCTGAAACTTTGGCCCAACAATGCAGTGGCTCAACTTCATTATGGACTAGCACTCAGACAGTTCCATGCTGATT
          ACGCCAAGGCGCTGCCTTATCTAAAATATGCCGTGGAGTCTGGAGAGGAGGGCACGCAAGAGGCTTTCTTCTATTTGTCG
          CTGGGCGAGACCATGCAGCGCCTGTCCATGAAATCAGAAGCTCTTGAGGTGTACGGTAAAGGTGTTGCCAAAGGATTCTT
          TGCCAGCCTCTATCAGAGATCGCTGTACAATGAGCCCAGGTTGAGAGCACAGCCATTTTGGCAGCCCAAGGAAACGGGCT
          ATGAAAGGCAGCTGGAGAAGCTGACGCTCAATTGGCGTGCCATTCGCGATGAAGGACTAGCACTGCTGGGAAGAAGTGGA
          TTCTTCGAGGATGAAGCGGAACTGCTGCGCGACAAAGGAGTGTGGCAACAGTATGAGCTATATGCCCAGGGTCGTCGGGT
          GAAGGACAACTGCCGCAGGGCCCCAATCACCTGTAGCCTGCTGGAGGAATTTCCCGAGTCCGCCGGCTGTCGACGTGGCC
          AAGTGAAGTTTAGTGTTATGCAGGCCAAGACGCATGTGTGGCCGCATTGTGGACCCACCAATTGCCGACTGAGGGCCCAC
          CTCACGCTAGCTGCTCCGGAGCCGGAAAAAGCATCACTCCGCGTGGCGGAGCAGGAAAGAACCTGGCGTGAGGGAGAACT
          GTTCATATTTGATGATAGCTTCGAACACGAGGTGTGGCACAACGGAAGCCAGTCACGCCTTGTGCTCATCCTAGATATGT
          GGCATCCGCAACTGAGTGCCGCCCAGCGCCGCAGTTTATCACCCATTTGACCGGTAGTCACTTAGTTGTTCTATTCATAG
          TTCCGGTTCCTAGGCCTGCAATTTAGTTTAATTTCTACATTGTTAGTTAAATCGCCATGTTGTATAGACATTGTAATTAT
          ACCTCTTAGTCGTAAGTTCGGTTTGAATGCGTGTTTAGGCTATGTAGACGTCAATTCATCTGTGTATCATATACGATTAG
          CGTTGGCTGGCAGCTTACCCTCGCTTTTCTACTTGACAGAAATAAAACCTTTTAGGATTTGAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0087220
          2729
          FBtr0087219
          3143
          FBtr0300575
          3928
          FBtr0305091
          3986
          FBtr0305092
          3197
          FBtr0310447
          3929
          FBtr0336734
          3518
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0293627
          803
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0086359
          785
          FBpp0086358
          382
          FBpp0289802
          557
          FBpp0293628
          575
          FBpp0293629
          400
          FBpp0302595
          556
          FBpp0307715
          991
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Asph-RH
          Secondary FlyBase IDs
            References (0)