Open Close
General Information
Symbol
Dmel\CG42404-RD
Species
D. melanogaster
Annotation Symbol
CG42404-RD
FlyBase ID
FBtr0305613
Feature type
Associated gene
Evidence Rank
Length (nt)
4825
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 13 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GAGTGCTAACTAACGCGTGCAATATGTATTTTTTGGCATTGCTTGCGTTTATTGGAAATGCCAAAGATGGAAACGCGGTG
      AGCTCGAGCCTGATCCCCGGCGGCTCCTGCCGCGATTACAATGGAAAGATGTACGAGACTGGCATGCACTATATGCCGGG
      ACCCGACTCATGCCGCCTCTGCATCTGCGACAGCGGACTGCCCAAGGCTTGCAAGATGGTGCTCTGCGAGGCGTTCAGCA
      AGTGCAAGTCCTTCCAGACGGTGGGCAGCGGCAACAACTGCTGCGAGGTGATCTGCCTGGATGACCAGTTCAGCGATGGG
      AGCACCGACTTCGGCATTTGACTGGTGGCCAGTGGCATCACGGCCACGCTCTCCTTGTCGCTTCTCTTCTTTCTGGTGAA
      TCGCCTGAGGCAGCGGAAGATGCGGGCGCGGGAGAATCGCCAGAATGCAGAGGATCAGCGCAGCATTGTGGGCAGCATTG
      GCTACATAGCCGGAAACATGGGCTACATGGAGGGTAATCTGAGTGCCATTGATTATTCCTACAGCGGCGCCGCAACCCAC
      TATCCCTTGTGGAAGCCGCATTTTCCGCGTGGTGAAGCTCCACCGCCGTACGAGGAGGCAGTGGCCATCTCCCAGGCGGA
      GGCGCTTAGTGCCCAGTGCACCGTCAGCCTACCAGCGAGCTCCCAGCGAACGGTAGCCACGGTTAGCCAGCAGCAACAGC
      AGGCAGTGGCCCAGGCACAAGCCCAGGCTCAAGCTCAGGCTCAGGCCCAACAGCAGCAACAGATCCAGGCCCAGGTGCAG
      GCCCATCAGCATCTGCAACAGCACACTCTCCAACTGCACACTCAACCGCAGCAGCACCACCAGCCGTACAGCCAGCAGCT
      TGTGGCTCATCCGCATCCACAGCACCCGCACTCCACGGCCAATGTGCTGCCCCAGTCAAATCAGTACACACAGAGCACCA
      CCAACTTAATTAACATCAACATCAATAGTGGCGGGGTGACCACCATAGCCACCGGGGAGAATCACCAGCCGCCTTACAGT
      CTGCAAAGTGACCACCAACTCAGTCTGGAACAGCAGCAGCAACAGCAACAGCAGCAGCAGCATCTAATGCAGCCTCCGGT
      CAGCAGTGGTTCCATTTGCCTCCAGGCGATGCCCAAGCCGCCAGTCTCCGCCGAGTGCAGCTACAAGAATTGCCACCTAA
      ACATTAGCGCCAGTGTTACTACTGCGGCAGCCAGCTCCAGTTCGGCAGCCTATACGTCTGGCCGAAGGACAACTCCCAGG
      GGATCCCAGGAGTTGCTTCATCAGTTGCCACAGCAGCAGCAGCAACAGCAACAACAACAGCAGCAACAGTATCTAACCGT
      AGCCGATGTGGAGATCAATGCTAGTGCCAGTGCCGCAAGTTATCATTCCCTGCCAGCAGGTAGTGGGGAACTTGTGGCCA
      CTCCCACACACGCACAAGTGTTGCAGCATCAACAACAGCAGCACCAGCAGCAGCAGCAACATCTGCTGGCGGCCATATCC
      TCTCCGGGCATGGAGATACTGCAGCCTTTAGAGATAGCCACAATCTCGTCGGCACCTGCCTGCAGCACAGCGGATTCAGT
      GACCCAGACCACACAGATGCCTCTGCACGGAACGCTGAAGAACAGCCAGCCACAGCAGATGAGCAAGACACCCTCCAGTT
      CGAGGCGCTATCACCGCACTATTCCGCGCTATTTCGCAGTGGCCGACCCTCTCCAATTAAAGCCCAAGACCAGCAGCAGT
      GCCACATCCACTGGTGATAAGCAGCAGGCCAGTAAGAAGCCCATGTGCCAATGCCCCATCCAGCACGTGCCCATGTCGTA
      TATGGGGAGTACGGCCAACGCAAATGCTTTCTTAAGCGGAGCCGGCAAACTTTTCACCGGAAACTCGACCAGCAGCAGCA
      CCTCAACACCGACGTGTTCCCTGTCTCCGGGAGCGGCGGCCACCGGTGGAGTTCGTCATGCGGCCACCTTGTCCTACGGA
      CAACGAGCCAAGTCCTCGTCGAACCTGCAGGCGCAGGATCTAATAACGGCAGCTGCTTCGGGTGGTGGAACTTTGCGACG
      AAGTGGTTGTGGACATGAGCCGAAGATAGCCACTATATCCAAGCAGGTTGGCGATGAGACGCATCATGGCCATACGGCAT
      CCAGTGGTGGAGTCAATGTGTCGGCCATTATACCACCGCCCCCGCTGCAACATCCCGAAGAGGTGTCTGCGCCGCCAATT
      GTCCTGGGTCGCGTGCAGAAGAGATCATCCAGCAATTCTGCCGAACGGGGAAGGAGCTCCAGCGGAGGAGGCAGTGGCGG
      ACGCAGTGTGTCCAGTGGCAGCGGTGGCGATTCCCTATCCAGCGTCTATTTGAATCGAAAGGTTGATGCCTACTTGAGTT
      TGACGCAGAAACAGCAGCAACATTTCTTTAACCAGCAACAGCAGCAGCAGCAGCCAGATCCAAGCAATCCGACTTTACCA
      CCGAAACTCTACAAAAGCCTAACGAATTTAAAGAGCGCCACCGTGGTCAGCACATCCTCGTCCTCCTGCTCGTCCGGCAG
      CGGGAACAACAACGCCGTGGCCACCATTTACACGCTGAGCAAGCCGGCGACCAGTGGTCAGCGCAAGGAGCAGACTCCCT
      CGCTGACTCTGCCGCCGGCCAGTCCAGCCGCAGGACAGTCCGGCGAGAAGCTGACCAGCGGCAAGATCAACTCGAGCACC
      TTCTATCCGTTGGCCAATCACGTGACCTACACCCTGCCCAAGCACATCAGCGGCAAAGTGTCGTTGAACAGCACCATCAA
      CAGCGTGGTCAGCAAGGTGCCCTCGGTGATCAGCATTCCGCCAGTGGAGAACAACAATCCGGGCGGCCAGACAGGAGTGC
      CGGCCAAAAGCACCACACTGCCAAAGATCCTGCGCGTGAAACGCGATCCATCGTCGGGGTCGGGAGAAGGGGGGACTGCC
      ACGAGTCTGGCGATTGCCCACTGCCAAATGCCCAGTTACCCGCTGACGACGAAGGCCACCAACGGAGGAGGAGGATCCAC
      CGGACGGTCGCCCAGCAAGCAGCTACCCGTGTGCACCACCTCGAAGAACTGCCTAAATCCCAAGGAGCACTTCCTGCCCA
      ACGACACCAGTCTGGACGATGACTACCTGAGCGAGTGCGAGAACTGTAAGATAGCACAGAGCGCCAAGTACTTCTTGGAT
      GCGGAAATGAGCGGCGGCGGATCCGCAAACTCGCACCAAGAGACGATGACGCTGCAGCGGAAATCACTGGAAGAGACCAA
      GGAGGAGCCCATGGAGAGCTACTATCGCAGCTCGCACACTCTGCCCAGCAATGCCAAAAAGCATGGCAAGAATAACAATC
      GGGAAAAGTGGCAGGTCTCGACGATTCCAGCTGCCAGCTCGTCGGATGAGGACATCAACGAATGAGATTTAAGCCATTTT
      CTTTAAGATGCCCGATCGCCGGCCAGAAGAGCATCCTAAAGAAAACGCAGGCTCCAAAACCACACCACATCCAACCACAC
      CCCGCCCCCCCTGGATAGCTAATCAACGTAGGTAACCAACCAATTGCTGCTGCAACGAGAGACAGATCCTGTACATATAT
      ACGAATATTAAAATAAAATCGCGTCATTAAATATTTGTAGAAGGTAACCAACTGATTGTTAGATTTAACCATGACTAACG
      ATACTCAACCCAGAAGCGGCATATAAATCTGCGTGTTTGTTATGCACCTGTATATCTTTGTACGTATGTAATTGAATCTG
      TACCATACGATATGATATGAAACGATAGGATAAGCAAAGTTAGAGCGGGCATTAAATCAATTATAACCAATGTATTATGA
      AGATATTAGCGGAAATGTTGAATACTTAGCATATATGAAATTGATCATTAAGATGTCAAACCCTACTGCCATCTGCCATT
      TTGCCAACGTTAACTGTCAATAATTGTGTATGTATGTAATATTTAAATAATGAATGTAAGAAACTCAAGTTTTTATATAC
      AACTAAAGGAAGCTGACCAAAATTCAATGTATTTCCCTGCTGCTCATTCCCAAAAGATGCACAAACATTGCACATACGAA
      ATCTAGGATAAACCAATTGACATAGGCATACATACTCGTAAATAGAGGAAACCATAGGATACGAATTTAAATTGAAAACT
      CATTATCATTTTATTCCCGCTTTATATAAGACGTCGGCAAACGTACCGACCGACAAATGCTTTTCTAATTTCCAAAGTTT
      CCATCTTTTACCAGTCGAATCAATGAATGTACCATATAGAATGAAACTGCATACATCAGTATGCATTTAGGCGTAAGAAA
      TCGTTTTCAGTCGTTTTTGTGTGGGGTTTAATAGACATTAGACGGTTTCCTGATCGATAACGAAGGACTTGCTAGAGAAT
      AACATTCGTTTAATTCTTGAATTGGGCGGGTCCTAGACAGTCTAATGCCAACGATATAAGCACGATATGAAATTATATGT
      ATGTACATGGAATACAGATAGAAGAGCAGCGCTCCACGAGAAGTGGGCGAATGAATTCTTTAATTCAATTTGCTAGTTAC
      TAGTCGTAACCACACTAAGCCAAGCGCGTTACTCAAGCAATTAGTCGAAGCCAGAGATACCCCCAATAAAATACATAGAT
      ACTACTCAGTAAATTATCCTGGTTTGTCCTGCCCTTAGTTCTTCTTTAAGTTAAGCTACCCCCATCCCACTTACTGCGGA
      TGGACGGAGATGGATGAGGAAAGCTTGCTCGAAAACGGTTCCTGTTCCGCTTTTGGTTGTAATAGATCTCTGACCTGAAA
      ACTGTATTGTGTTCAACGGATGCTC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0305614
      5523
      FBtr0345173
      5536
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0294061
      1133
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0294062
      1133
      FBpp0311382
      105
      Comments

      Stop-codon suppression (UGA) postulated; reflected in aa sequence of predicted polypeptide.

      Transcript terminates at site supported by polyadenylated cDNA.

      translation_exception: stop_codon_readthrough

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG42404-RD
      Secondary FlyBase IDs
        References (0)