Open Close
General Information
Symbol
Dmel\dj-RC
Species
D. melanogaster
Annotation Symbol
CG1980-RC
FlyBase ID
FBtr0305962
Feature type
Associated gene
Evidence Rank
Length (nt)
1209
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 4 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CACAGACAAATAGTCTCCAGCTGTGGTTTTTTCAAAATTCTTTGTAAAACTTTTGGTACAAAATTTAAAAATTTTTCTCG
        AAATGTTTAAGAGAACCGCTTTAATTTTACGTCGGTGCTTTCAGCCCACTTTTATACGGCCTCACCACATCAATGTCCTT
        GAGAACTTTAAGGAAGGTATGCAGTGAACTCATATGCCTGGTTACCACTTGTTACTGTTAATACTACTTCACAACCGATG
        ACCTTCCCAATCAGGGGCAAGCAAAATTTGTCGATGTCTCTATTCACGATCCGCAACACATTCGTTCTGCACTCGTCAGT
        CCAATGCAACGAAAGTTCTTGCAAGACCTGGAGCAGCAACAGACTGTTAGGATCAAGTGGTTTAAGGAAGGGAATCAGGA
        TGAACTTGAAAACATGAAAAATGAATGCCGGAGGCTAGCTCTAGAAATCATCATGGCTGCTAAAGGTGGCGACATCAAAA
        AAGCCTGCAAGGAACTGGCTGAAAAAGAAAAGTGCAAGCAGATAGAACTGAAAAAGAAATGCAAGGAATTGGAGAAGAAG
        ACGAAGTGCGCGAAGAAAGACCCTTGCAAAAAGAAAGATCCTTGCAAAAAGAAAGATCCCTGCAAAAAGAAAGATCCTTG
        CAAAAAGAAAGATCCTTGCAAAAAGAAAGATCCCTGCAAAAAGAAAGATCCTTGCAAAAAGAAAGATCCGTGCAAAAAAA
        AGGGTGGGGACCTAAAAAAGAAGTGCAAAAAATTGGCCGAAAAGGAAAAGTGCAAAAAACTGGCCAAAAAAGAAAAAATG
        AAAAAGTTGCAGAAAAAGTGCAAAAAAATGGCTCAGAAGGAAAAATGCAAGAAAATGGCTAAAAAAGACAAATGCAAGAA
        AAAGTGAAGCTTTCGCGGATTATTCAATGAAATACATACGTACCTGGTTTAATTCATTCAGCTCTGTTCAACGCGGCTTT
        ATCTAAAATATGGTTTTTTCATAATATACAATACGGCATTTTACCGAAAAATTAGATTTTATTTATTTAAAAAAATAACA
        AGGGGGAAAACAGTTAATGAGCATGTAACCCCCAGCTTTCGAGTAATGAGTCCGTGGCAAGATTTCGTCGTTCATACGGA
        CAGACTGATAGTCAGACGGTCATGTTTGTTAAGGAATCTATCTATATATATATATATAGATTTATATATCATATAAATAA
        ATATGATTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0089742
        1152
        FBtr0089741
        1132
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0297104
        187
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0088683
        248
        FBpp0088682
        218
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Based on cDNA(s) that contain premature stop codon and/or downstream start; may or may not produce functional polypeptide.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        dj-RC
        Secondary FlyBase IDs
          References (0)