Open Close
General Information
Symbol
Dmel\PGRP-LB-RD
Species
D. melanogaster
Annotation Symbol
CG14704-RD
FlyBase ID
FBtr0306097
Feature type
Associated gene
Evidence Rank
Length (nt)
926
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATGGGCGACAAGGTGTCTGGATCCGTCTCCACTTCTGGCCCAACTTCCTTGGCAATCCTCATGGACTCGGAGCAATTGGA
          GCAGCAACAGCTGGCCACAAGTTGTGGCTATAGTCAGCACATGCAGCAGGCGAATCTGGGCGACGGTGTGGCCACCGCCC
          GCCTGCTGTCCCGATCCGACTGGGGTGCCCGGCTGCCCAAGTCCGTGGAGCACTTCCAGGGTCCCGCGCCCTACGTCATC
          ATCCATCACTCGTACATGCCGGCCGTGTGCTACTCCACTCCGGACTGCATGAAGAGCATGCGGGACATGCAGGACTTCCA
          TCAGCTGGAGCGCGGATGGAACGATATTGGTTATAGCTTTGGCATCGGCGGCGATGGCATGATTTACACCGGCAGGGGAT
          TCAATGTCATCGGAGCTCATGCACCCAAGTACAATGACAAGAGCGTGGGCATTGTGCTGATCGGAGATTGGAGAACCGAA
          CTGCCGCCCAAGCAGATGCTGGATGCGGCCAAGAACCTGATCGCCTTTGGCGTTTTCAAGGGCTACATTGACCCTGCCTA
          CAAGCTGCTGGGCCACCGACAGGTGCGGGATACCGAGTGTCCTGGCGGCCGCCTGTTCGCCGAGATCTCCAGCTGGCCGC
          ACTTTACCCACATAAACGACACCGAAGGCGTCAGCAGCACCACGGCGCCCGTCGTGCCCCACGTCCATCCACAGGCGGCA
          GCACCACAAAAGCCGCACCAATCCCCGCCAGCTGCGCCCAAGGTCTAGGCTGGATTGGAGGGCCCTCATCGTCCTCGCAA
          AGCTTACGAGTTTAAGAGAAGCCACAACGAGCTCGGCTCCACGCACAACGCCAAGGAGTTCATTCAGTATTCATTAGATG
          TCTCTTCTAACATTTCACAAATAAAGCAATTTCTAGATGATAACAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0082398
          1129
          FBtr0082397
          1068
          FBtr0082396
          1255
          FBtr0306098
          925
          FBtr0306099
          1234
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0297234
          255
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0081874
          215
          FBpp0081873
          215
          FBpp0081872
          232
          FBpp0297235
          215
          FBpp0297236
          215
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          Supported by RNA-seq data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          PGRP-LB-RD
          Secondary FlyBase IDs
            References (0)