Open Close
General Information
Symbol
Dmel\larp-RG
Species
D. melanogaster
Annotation Symbol
CG42551-RG
FlyBase ID
FBtr0306389
Feature type
Associated gene
Evidence Rank
Length (nt)
7915
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 72 )
Sequence
GCTGCTGCATAATAATATAATACCTCTCGATTCACGATTGGTCGTGCCTCGCAACGGATTTTCTCCGCTCGCCCAAACTG
CAGTATATAATCGTGCAAAATCCGTGGCAGTAAATTCAATTCGCCGAGGAGCGTGACAGCTGAGGAAAATCGAGAAAACG
GCCGCTGGGAGAGGCTTTTCCGATGGCCAGTTCCTAAAAAATCACCGCACTCCTCGGGAGGCTCTTCTGCAGTCCCACAA
GAATAGTAATCCCCATTGCGAAAGCCCCAAGTTCAAAGTGCAGTTTTGGAAGCCTATCTCTGGAGCCACCACATCCCGTT
GAGCAGGCAAGGAAGCAGACAAGAGTTTCCCCAACCCGACAACGAGGATCAGCCGCTGACGTAGCCGGAGCAGGAGCAGC
GAGTGTGCTGCCCACTCTGGAGAGGAAACCGGAGTCAAAGAAACAGCAGGAGTAGCAGCCGCAACTGAGGAGCATGTCCA
GCAAGGAGGAGACGCCATCCACGGGAGGTGCCGCTCCTGTGGCCACTGTCGCCGCCTCGGGCAGCGCCACCACTTCCTAC
GCCAATGTGGTGCAGAACCTGGAGACCAAGAAGTCCGGCACCAGCAACACCACCACCACCACCGCCAGAGCCACCGTGGA
CAACAAAGAGAACCAGCCCAATCTGAAGAGCTTCAAGTCGTGGAGCGAGGAAGCCGCTGCCGCCGAGGCAGCCGGCGAAT
CGCCAATCGTCGGCAGCGTTAGCCTAGCCCAGACGGGTGAGAAGCGTGCCGCTGCCTCCGGTGGAGATAACACCGCCGAG
AACTCATCGGAATTGGACGACAACAACGACTTCGTGCCGGTACTATCGCATCACCGCCGCGATCGCAAAAAGGCGCGCAA
AGAGAAGCCGCGCGATCAGCAGCCGGCCGGAGGACGTGGCGATGGTCAGAAACCCCAGCAGGCTGGTGGCCGCCGCGTCC
CCGGATCCTCCGACACCGAACGCAAGTCAGTGCGCCCACGTGCGCCGCGCGGCGGTAGTCCCCGCAAATCGGCAGCTGGA
GCTGCTGGCGCAGCCGGATCCAATGCTGGAGCTGTGTCCTCCGCCGTTCCTGGTGGACCGAAAGTACACAAGGATCGCAA
GGATACCTCGCCCAGTGCCAGCATCGAGGGAGCCGGCAGCAGCGGCAACGAGGCCAAGTCCGCCGACGGGGATCAGCAGG
CGGGCGAGAAAGGCGCCGCTGGAGCAGCTCCGCCGCCCAAGCGATTCATTGCCGCCCCACCGCCCAAGGTCAACGCATGG
AAGATATCGGCCAAACAATCCGGCAGCCCAAAGGCAGGAACTTCTCCATTGGACAAACGTGTTTTGCAGCCAAAGGCACA
GCAGCAGCAGCAGCAAACTAAACAAACTGCCAGCCAAAACAACAACGCACAGAACACCGCCAGCAACAAAAAGACACAAC
AGCAACAACAACCCCAACAGGGAGCAACAACAACCACACAGACAACAACAGCAGCAGCAGCAGCAGCAACCGCAGCAGCA
GCAGCAACAGCAGCAACCACATCAGCAGCAGCAGCAACATCATCCGCAGCAGCAGTACCAGCAGCAACAACTGAAACCGC
AACAACAACCACTGTTGATGCCAGCCAGGCGGATGCTCTTGCCAAAGTCGTGGTAAAGGACAAAAAGAAGGTCAATCAAA
AGGCCAGCGACTTTAGCAACGTTGGTGACTGGCCGACGCTAATTGGCGGAACTTCTGGCAGTGGCAAAGCCACCAGCAAC
GAACCCAAGCGCAACCCAACGAAAAAACAGCAGTCAGCCAAAACAGCAGCCGCAGTAGCAGCCAGCAGCAATACCACTTC
AAGTGAAGTTGCCACAGAGTCTAACGTCGCAGGCACAACCAGCAGCAGCAACAGCAATCCCAGCAGCAGCACCACCACCA
CAAACACCACTACCAACAGCCAAGCCACAACTGCACCTGTTGCCAGCACGAGTCATGATGCCAAAGCCCAGCGAGACGCT
GAGCCAGCGGCCAATTCTGCTGCAGGAACTACTGGCACCGCTGCCGGGCCTGCCCTCACCAAGAAGATACCCAAGCACAA
GTGGCGTCCGCTGCCCATCGATCTGGCTAAGTCCAGTCGCCCCAAGCCGATTGGCGGCCGGCCAAATCGGCGCTTCAGCG
ACGATATTGCCGACCAGCGCCGTCCGCCGCGCGTCTACCACGACCGTCAGCCCGGTGCTGGAGGAGCGGGAGTCGAGTCG
CGGCATCCACACGCTGGCCGGCATCCGTACGGGTCACGCCCAGCGACTGCTACGTCCGAGCGCGTGGATTCCTGGCGTAG
CAGCAGCAGCACCACCACCGCAGCGTTCGATGAGCAGCGCTCTGGAGCAGCGGGTGGTGCCGGGGCAGCGGGAACGGGAG
TTGGGTCAGCCACGCGCGGGCCGCGTCGCTACCGGACGCCGTACCGTGGCGGGCGGCAAGGCCGGGGCGGATTCTCCCGA
CAGGGACCAGGTCGCCCGACTTATCGCATACCACGCCATCTGCTAGCTTCGGGCGAGTATGCCAACTATCTGCCGGCGGA
CGCCGCCGGCGCCGACTCGCAGTCCTCGTATGTGCTCATGGGCACCCACTACTTTGGCAACGTGCCCGCCGCCTACATCG
AATTGGACGCTAACAGCATCAAGGAGGCCATCAAGAAGCAAGTTGAATACTATTTCAGCGTCGATAATCTTACCGGCGAC
TTCTTTTTGCGCCGCAAAATGGACCCCGAGGGCTATATCCCAGTTACTCTGATCGCCTCGTTCCATCGCGTTCTCGCACT
GACCACCGATGTGGCTGTGATCGTAAACGCCATTAAGGAATCGGATAAACTGGAGCTCTTTGAGGGCTATAAGGTGCGCA
CCAAGACGACACCGACCACCTGGCCCATCACGGAAGTGCCGGAGGTCAACGAAGGGGAACCGAAGGCTATTGGCACACTG
GAGCAGGAGCAGTTGGAGCAGAATGATGGTCAGGAAAAGCTGGAGGAGCAGACTGAGGCGGATTCCCCGCCGCCCATTCT
CACATCGGCGATGGCCACAAAGCCGCTGAACAGCATTCCGCCGCCGCCAATGCCGCGAAACCCCCAGAATCTGGTGCCCA
AAATGTTGCAGGATAAGCAACAGTCGAGATCCTCGACCATTGCGGCTCTAAACTCTGTGAATGCGATCAGTGCGCTGACC
CAGCAAGTGGAGGGTGGTGCCGCTGAGCTGGCTGGACATTTGAGTGGACTGGCTGAGAGTGTGAAGCCCAAGTCGACATC
GACGCCAGACAAGAGAAATGCTGCTTCAGCGGGCAATGGAGCTGGGTCAGCAGCTGCTTTGGTGGCGGAGCCGGAGGGCA
TATGGAAAGAGGTAAAGAGACGCTCCAAAACAAATGCTATCAAAGAAAACGCTACTACACCACCACAACAACAACAGCCA
CCGCTTTCACAAACGCTCAACAACAATAACGATAATGTCAAAACGAACAACACCTCGTCCAAGTCCAAGTCCTCGTCCAA
CAACGCCCCATCCAACGCCTCATCATCAGCCACTGTGTGTGTAACCACGAACAATGCTTCCTCAGCCACCAAAGCAACCA
CCAAAACCACAACCACCTCCACCGCCACTACCACCACGAACAACAACATTAAATCTGGCAATGCTGCTTACTCCAAAACC
CACTCCAAATCCTCATCCAAAACAGCTGCTCCGCCATCCGCTCAGTGCCATGCCGAAAAGGAAGAACTAGACTTCCAGTT
TGACGAGGAGCTAATGGACCCCCTACCCCCTGGAACCGGACGCATCAACAACTTCACCGAAAACTTCTCCGACGACGACG
AATCCGACTACGAGTTTGCCGATCGTGACATTAACAAGCTACTGATTGTGGCCCAAGTGGGCCGCGCACCTAAGCACGAG
GGCTACGACCGCACCGCCGACTTTACGTCGCGTACGAAAATCACCCAGGATCTGGAGAACATCATCAACGATGGACTGGT
TAACTACGAAGAGGATCTGTGGACCACCACCAATGTGGTTGCCGATTACAAGACTGTCAATGTGATTTCCCAGGCAGACT
TCGAAAAACTGGCTGGTGGTCGAAACAAATCGGTGTTGCCGCCGCAGGTGGTGCCACCACCGCCACCATTTGAGGAAGAT
CTGGATGAAACCCTGGTGGGTGACACCACTCTCAACTCCACGCTGAACAACACTCTCAAGTCCCGACGTGCCCGCTTCTA
TGCTGCTCCCAACTCGCACTCGATTGATCCCCGAACGCCAAGAAAGAGGAAACTCCGTCACACCGCCAATCCTCCAGTGG
AGGCCCACGTCGGTTGGCTGCTTGACACTGTGGAGCATCGTCCTCGCACCACCTCGATGGGTTCCTCGGCGGGCACATCG
CCTACCGCCTCGTCGTACGGATCGTTCGGATCGTCGGTGCCACAGTCGCTGCCCGTATTCCAGCATCCATCACATGCTCT
TCTCAAGGAGAACAACTTCACCCAACAGGCCTACCACAAGTACCATTCGCGCTGCCTCAAGGAGCGCCGGCGCTTGGGCT
ACGGTCAGTCGCAGGAGATGAACACCCTGTACCGCTTCTGGTCGTTCTTCCTGCGCGAGAACTTCAACAAGAGCATGTAC
AACGAGTTCCGATCGTTGGCGCTGGAGGATGCCGGCAATGGTTTCCGCTACGGTCTTGAATGCCTCTTCCGGTTCTTCTC
GTACGGCTTGGAGAAGAAGTTCAGACCGAATATCTATCAGGATTTCCAGGACGAGACGATTGCCGATTATGAAACAGGTC
AACTGTACGGCCTCGAGAAGTTCTGGGCCTTCCTGAAATACTACAAGAATGGTGAGAAGTTGGAGGTGCAGCCCAAGCTG
GCCGAGTACCTGAAGAGCTTCAAGAACATTGAGGACTTCCGCGTGGTGGAGCCGGAGATCAACGAGATGCTGCAAGGAGT
GGGCAGCCTGAATCCAGGCCGCCAGCTCAATCGCCACCGCAGTGTGTCGGAGAGCGATGGCACAGCTGTAATTGCGGCCG
GCGGTCGTCGCCTCAACACGACCATCACCAACCGCAGCGACTACGTGGGCAGGTTGCTGCAGCAACAGCACCAACAACAG
CAGCAGCAGCAGCATCACCAGTATCAGCAGGGATACGGCGGCTACAATCAGCAGCAAAACCGCAGGCGCACAGGCTCCTT
CGGCAGCACCACAGTGCGCATTCGCAGCGGCTCCCTGGGCAACAAGCCGCAGGTGGCCAATCGCAATCAGGGATCGCAGC
ACGAGTTGCGACGCGGCGGCAGCAATTCTGGCCTGGCGCCACACAAGCGACAGCAGCAACAGAAGCCGAAGCCAGGAGCA
GGATCACAGACAGGCTCAACACGTGCCACCACATCAGCGGCAGCTACAGCAACAACAGCCGCATCAGCAGCAACATCAAC
AGCAGCGACGCCAGCGGTAACGGTATCTTCGGGGTCATCGTCGTCGAAGAAGTAGTTACACGATAATGCAGAGACACTTT
TTGGATTAGGCTTAAGTTAATATCTACCGCTTAGTTTTCAGGGGGCACTCGCATTTGATGGCTCCACACTCTTTTGTTTA
TTCATTCTTATTATTCTTTTGTAGTATTCGAGTCAAACGTAAAGTGGGAAGAGTTGTTAGCGTTTAGCATAATTAAGTGA
AATTTTTGAAATTTGTTTATTGCAATTTGCCTAGCGCTCGTTGGTTTAGTAGTTACGATTCCAAATGTTTGTTTCTCGCA
TACCCTCGACAAAAAACTAAAACAATGGTTGCTTACAAAATGCTCAATGCTCACACAAAACACACACACACACATACCAA
TTACACACAGCGGGGTCTGTCTGCTTTGTACCAGTGCCAACCAGCCATGATCTTGGAAAATAACGAAACGATTGCCCTTA
TTTTTTTTTTTTGTTCTGTTAATTATTCTCCTTATTTTTTATGCGATGCAAAAATCAAGGCAAAGATTTTCCTACTTAGA
GCAGCGTTAATAGTTGACGTAATGCCATGAACTGTTGTACTATACGATTAAAGTTAAAGCTAATAACCATAACAATAACG
ATAACGATATAACCTATGCAAATATTACCTAACGAAAACTGAAAACCAATCAATCGAAATTGATACGCAAGCAACAACAA
AAACCAAATGATCTTAATGCAAATAAATTTTGTAAATTACGAAAGAACATATATATATATATATATATATATATAAACAT
ATATAACTTTATATGCAAAGGTACACTGAAGCCATGAAAACGCGTACATAAGAATATGATTACTAACTATAATTATGATT
ATTTTTTGTGTGTGTGACCTTAGCGCAAATGTAAAATGTATTTGTTTAAGAGGCAGCGAGATCTTGTAATCCTTAAACCC
AATTGAGGCAAGCGGGACTCAAGTGCCAGCGAATTTTAGTTATTTAAGCATTTACCACAAGCCAGTCCAGCGCAATCGCA
ATCGCCAGCGGAGTAGGAATAGGAATCCGACTTGGACTCGGGTCCACCATTATCACACTGCACTCTCCCCAGTCTATATC
AATCCAATCTATCGAATTGGTTAAACCCGAAAACCTCAGTACCCCGCCAAGCATTTAGAAGCATGTCAAAACCATTTATT
TTTTACCTTTAGTTTTGCACTTGTTAACTTTTAATTCGAGAAAGCTACGACTACAGAAAAACTTAGAAAAAAACAAAAAA
AAAATTTAAAATCACACAAAAATTGTCAAGTCCAAAAAAAAGTTTAAAACTTTAAAAAAACGAAAAGGCAAATCATGCAA
ACGAAAAAAAAACCATTCAGAAATAATGAAGTTTGTTTCGCATAGTGAATAGACCTAAACTTAAACATACGTGAGAAATC
AAATCTAAGCTTAATACGGATAACAACTATATATATCTGCATATATCCAAACACATATAGAGAGACTTTAGAGCGTGACT
GCTTTTGAAAATACCATAACTAAATAAGAGGCAAACGGTGAAGTTGCAGAAGTTTGCAAAACTCTCTCAAGGTCCTTTAG
CTCCTCGATTTTGCTCGCTCATCTAGCCTAAGCAAGCATACACACAACACACACTACAAACCACACAAATTCGAAGAGTG
CAAAGAACGTTTCATTAAATATTATTTTGTTATCATTAGATATCTGTAAATATATTTCCCAGCTTCTTTTTAAAATGTCG
CCTTATCAATTGATACAATTTTATCCACACATAAAAACAATCACATCCGCATTGGCCAGACGCTTCTCTATCTGTATGAG
CTTAACGATCCGATCTATCAATATTATAGATATTACAAAATGAGAGAGATGTCCGACGAGACAATTCAATCGGCTGTTGT
GTAATTATACATATGTAGTTCTGCCACAACTATTTTGTTTTTCACATGAAGTGTTGACTTTAGTTTATGATAACACACAA
CCAACCACACTTGGATCACTGACTTTTATGTGCACTTTAAGTTTGCAACTTTTATATGAATAATTTAAACTTAACTCTAC
GAATATGATACGATACACACAGACCTACGAAATGAACATAATGGAAACTCTATTAAAAGTAATTTTGTAAGCTACTTAAA
TATGAAAAATGCGAGAGGAAAAGTAAGCAAAACGAAAGAAATGATTAATGTGAAAAACGTGATAGTTTAAACCATAAAGA
GTAATATTTACTACTATTATTATATTAATAATTAATTATACGATGCATATATACATATATATATATAAATATATATGGAT
ATGTATGTGTAAAACGGAAACCACAAAAATTTCTAAACTAACGTGAACAAAAAAAGTAAAAAATTTTTTTAAAATTTCCA
ACACAAAAAAATGTTAAAAACAATGAGTAGAAAAACTAAAACAAAAAAATGAATAAAAAAAAACTTGAAAAAACC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0089680
6745
FBtr0089682
6757
FBtr0301180
8064
FBtr0301181
6820
FBtr0306388
7070
FBtr0306390
7919
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0297481
1673
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0088622
965
FBpp0088624
965
FBpp0290398
1673
FBpp0290399
965
FBpp0297480
1409
FBpp0297482
1673
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
larp-RG
Secondary FlyBase IDs
    References (0)