Open Close
General Information
Symbol
Dmel\Hers-RE
Species
D. melanogaster
Annotation Symbol
CG32529-RE
FlyBase ID
FBtr0306520
Feature type
Associated gene
Evidence Rank
Length (nt)
9896
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 35 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATTGGGTTATTTATTTTTTTTCCTGTGATTTGTTTATTGAGTGAGCCCTGTACGATGCGATTTTTATGTGCGAATAGTAA
      ATATTTCGGCCCACGGTGCCATCCGATTCAGATGGAAAACACAATTGGTTTCCAATAGGAAAAGTTTGCATCATGTTTTC
      GTATGCCAAACGCTCGACGTGTGCGTGTGCGTGCGCGCCGCACAAGTTTGAAGTGAAACGCGATCGGCAAAAACAATAAA
      TCTCACCACAAAGTGGAGCAGCACCCACAAATAAATAAAAACATAAATAAAAGTGCGCCCGCCCGAAAGTAGGAGAACAA
      CAAACGGCTTAGGAAGCATCGCGAAACGTCATTAAAGGTCGGCAGATGGGCGGCCTACGGATTTTCGTGCCCTCCGCTGG
      CCATTCTCCTCGTGCTTGCTGCTGTTGTTGTTGTTGTTGCGGCTCCCAGAGCAGTTGCAGTTGTTGTAGTTGTTGTTGCT
      GTTGCACTAGCTGCAGCGGACCAACGGCCACAGCGCAGTGAGAGCGAGCGGGACGGCAAGCGAGCGCCACTGAAGGTGCG
      AGCGAGAGCCCCACGAAATGGTCTCGAAGAAGCGCTCCAATGCCGCCGAGCGTGTCCAGCGTTCGACGGCGACTGCGGCA
      GCGGCGGCAGCAGCAGCTGCCGCAGCAGCGACGGCGTCCTCGACGCAGGGCAAGAAGCGGCCCGGGAAACAGACGAAGGC
      CTCCGGTGGCGGCGGCGACGAGGCGGATGACAAGAAGTCAGCCAGCAAAACAGATTCGGCGGCCAAGAAGCCGGCCAAGG
      ATCCAACGGGATCATCGGGCGTGTCCACAGCCACCACTGAGGGTGGTGCTGGAAATGGAGGCGGAAAACAAACGACCTCC
      ACCACGACATCATCCACATCCTCGACAACCGCCCCGTCCGCATCTGCATCTGCATCTGCTTCCAACAGCCTTAAATTGTC
      GCCGGAGGAACGACACGAGGATGGCAAGGCGCGGGCCATTAACAAGATGCTTAAGAGCCTGGATATCAAGATCCACGGCT
      TCGACAACCTGCTGCCTAGCGGCGAAGAGCGGCTCAACGACGGCGTGCTGAAGTCCTCCATTTCGGAGAATGTCAAGACC
      AAGTCGCGCGCAGCGGCGGTCAAGGTGATTTCCAGCCTGAATCCCGGCAAGATGCCGCCTGTAAAGCGAGTGCGTCCCTC
      ACCGGAGCCAGTTAGAGAAAAAGTTGCGGAGAAGCCGGCAGAAAAGGTACTCGATAAGGAGAAACCGAAGGCGGAGCAGC
      AGATCACGCCGCCTCCCGCTCCAGAGGAGTCTCCTGCCTCAAAGGTGCCCAAGAAGACGGTGCAGCAGGCCAAGAAGGCC
      AAGGTGGAGTCATCATTAGTACAGGCGACAGTTTTAACGACAACTTCCGCAGCTACGTCAGCACCCAGCTCCGCTTCCAC
      TTCCAAGCATACATCGACAAAGAATCCTGGCAAGAAATCAGCCCATTCAGAGCAGATGCCAAAAAAGGAGCTATCCAAGC
      TGGCCAAAATGGGCAAACCGAAAAAGGAAGCCAACTTGGTGAAGAGCACTGCCCGTTTGCCCGACTCAAATACGGAATCT
      GTGCAAATGGAACTGGAGGAGATTGTCAGTACGCCCACGGTGACGCCGACGCCTTCGGCCACGCCCACGGCGACACCGAC
      ACCCACAGCCACGCCCACGCTAACGCCAACGCCCACGGCCACACGGACAAGAACTCCCACGCCGACGCTCACGCCCACGC
      CTACACCCACCTCGACTCCCTCATCCACTGCCATTGCAGCGGGGCAACCCGCACCACCGCCGCCACCACCAGGGGGAGCA
      CCCAAACAGCGACCGAAGGTGAAGTACACGAAGACATCGGCGGGATCGAAGGGTCGCATGCAACAGGCGCTGAACCAGAA
      GGCACCGGCTGCCTCATGGAGCGGAGCCAAGGACATATACGACTTCAAGTCGGGATCGGAAGACGAGGAGCCGATCAAGA
      TGGTGCTGCCGTCGCTCAAGGAGCTGCGCGAGTTCTCAGATGAGGATAATAAGCCATTAAAGCTGTTCGAGCGGCAGGCT
      GAGAAAACAAAGGTTCAGGTTCAGGATGAGGAGGAGCAGCCACTGGTCAAGAAGGAGGAGAAGCCACCGTCCGAAAAGGA
      GGTGAAGGTGAAGTCCAAGGAGAAGGAGAAGGAAAAAGAAAAAGACGTAGATCCTTTAAGCAACGCACAGCAGTCCGAAC
      CAGCAGCAAAGCACACCACCAGTACTAGCACCACCAGCACCACCTCCATTACGTCGGTTAAAAAGCAAGCCAAGCGGAAG
      ATAGCCACTCCAATGCCCTCCAGTGCGGGGCGCAAGAAGAAGACGGTGGGCAAGGGAAAGGCCGCCGCAGCGAAGGAGCC
      TCCTCCCAGCGGCAGCTCCGCAGAGAGCAGCTCCTCCGAGGACGAGCGAAAGCTGAGTGCCTACAGTGGGCCCAAGCGAC
      ACCGGATGGCGTCGCTCAACGCGCTGGCCAAGGTGCAGTGTCTGTACGAGAACGAATCCCGGACGGCCCATGAGCTGGGC
      CTGTCCAAGGCGACGCAGCAGCCGCCACGCATTCGCACGCTGGACGGGAGTGACGACGACAACCACAAGGACTCGCCGCG
      TCACGGGGACACGGACAGGGACAAGGGATCCGTGAGTCCGCCGCACACATCGGCTGCACCTCCAGCCGCGCCGATTGCTC
      CACCCAAGGAGGCGGAGCCACGCAGGGAATTGCGCTACGTGCCCGGAGGCAGGGGAGTGGGCAAGCATTGGGAGTTCGAC
      AGCGACAGCGAGACCGAGGAACTGCAGCTCCAACAGACCTTGCCCCCAGTCAAGAAGAAGAAGCTGCCCAAGAAGGCGCC
      GCCCAAGAAGGTCGCGTCCAGCGAAACGGACGCCAAGCGGAAGAAGAAGTCGGTCCAGGTCGAGGAGAGCGACGATGAGG
      AGGCCAAGGAGAAGGAAAAGGAGAAGGAGAAGCCGAAGCCACCCAAGCAGCTGCCCAAGAAGCGCAAGACGGCCTTCACC
      GAGGAGCTGATCGGCGACTACAAGGGCATCCTGGCCAGAAAGCGCATGGCCAGCCTGAATGCCAGCGCCATTGTGGCGGC
      CACCTACGAGGTGGAGCGTCACTTGGACAAGAATTTGGCCAGCGATTGCAGCAGTTTCGAGAGCTACGACGAGCTGGACA
      CCATGCCAACCACCACCAGCAAGGTGACATCTGCGGCAGCTATCAAAACCGAGGTGATCCACATCAAAAAGGAGCCCAAA
      GAGTCCAAGGAATCTCTGCGCGAGCGGGAACGCGAAAGGGAGAGCGAGCGCAGGCGTGAGCGGGATAACGAGCTAAAGGA
      CTCCACCGTCGGCAAGATGTCCAGCCATTCGATCATCGAGGAGAGCAACGACTCCAAGTACTCGAAGGAGACCAAGGAAA
      CCAACACGGACACCACCATTACCACCACTGGCTACCGCGACTCGGCGGCCAGCACCAAGGACGCGAAGGATTGCAGCCGG
      CCCACCTCCTCGTCGGTCGTCATTGTCCAGGACACGGACGTCACCATCACCGGCGTCTACGTCAACGCCAGCAATGGCGC
      CGCCCAGGAGGCCTACTGCAAGATGCAGTACCGCGTCCAGTCGAGCGTCACCGAGGAGCGCGTCCTGCGCCCGGGCTCCG
      TGGAGCCGCCCAAGTCCTACACGCCGCTCAGCGCTCTCTCCAGCATGCTGCCGCCGGGAGCCAGCTCCGGACTCAGCGAA
      GCCCACAGTTCGCCGCCGCTGCCTGTCCATGCAGCGCCGACGGGGCCGCATGTCCTATTGCCCGGCGAGCACCTCAGCGC
      CGGCATGTATCACGCCCCCGATCTCGGCCTGCACACGGAGCACGCCCTGCCGGATCACCACGGACCGCCGCCGCCCTCGT
      ACGCAGCTGCTGCAGCAGCTGCCGCGGCCGCCGCCGCCTACCACGCCCACCAGCTGGCGCCAGGTGGCGGCGGAGTGCTG
      CACATGCACCACCAGCACCAGTATGCCGCCCACGCGGCCCACGCACATCACTACCAGCAGGCGGCCGAATACCACGGCGG
      ACCACCACCGCCACCGCATCACTATGGCGGTCCGCCACCGCAGGGCCACTATGGACCGCCGCCGGGTGCACCTGTTCCGG
      TGCCAGTGGCCGTGCCCAATACGGTGACCGTGCCGCCCGAGCGCTGTGATGTTGGCTCTCCACCGCCATCCTATCGAGCC
      AGCGCCTATCCGCCGCCGTCCAGTGTCGGCATGCCGCCGCCCACTTTGGGAGGCGGGTCGAGCGCCTTCTGCGCCCCCAG
      TCCGCTCCACCATCACCAGCATCAGCACCAGCAGCCGGGCCCAGGAGTTGGGCCACCGCATCACGATCCCAGTGGTTACT
      ATCAGCCGGCTGGACCGCTGATATCGCCGCATGTGATCGCCGCACCTCCGCCGCCTGCGCAAGTGAAGAAGCTGCAGGAG
      GAGGACGGTCCCGTTTCAGCCGCCGGTTCGCCCACGCAGCTGCAACAGCAACAGGCGGCCGCTGAAGCCGCCGCCGCCGC
      CGCCGATCAGGCGGCAGCCCAATCCCAGTCACAGTCGCAGGGCCAATCGCACGGTCACGCCCATAGCCACGCCCACAATC
      CGCAACAGGCGCAGCATCCGCCGCAACCACAGCCGTATCCGGCCGGCGCCGTGGCGGCCGCAGCAGCGGCAGCCGCCGCC
      CACCAGGGTGTGCCCTACTCCCGCTCGATGCACGCGGCCCAGATGCACTACTCGACCGGCTATCCGCCCAACTACTACGC
      TCCATATCCGGGCGAGGTCATGTGCTACTCGCCGCCCACCTACCCGCCCTACTTTTCGAGCAAGGTCTATCAGCCGTCGC
      ATCCCGCTCATCCCGCCGCTCATCCGCAGGGTCCGCCGCCGCCGGGCGCCTATCGCCGTTACCCCTACTATCAACACGCG
      GGTCCGCCGCCGCCGCACGAGCTCTACGAACAGCAACCGCCCCCGCCGCCCGTCTCATCCGGATCGGTGTCCGGGCCGGC
      GCAGCAGCAGCCGCCCACTAGCAGCCCAGCATCTGTTGGCGCAGCCGGAGCAGGAACAGCGGGAGCACCATCTGGCAGCC
      AGTTGGTACCGGCCCATCAGCAACAGCACCAGCAGCAGCACTTGGAGCACTATCCGGGACCGCCTAGCTACTACGCCGGA
      TACAGTCCCGGCGGAGGAGCATCCGCCGGTCAGTGCTACACGCGTGGACTGCAAGGACCGTATATGGAATATCCACCGCA
      GTGTCCCTGCCCAATGCCTCAATCGTGTCCAAAAAACGTCCATACTGGGCCTCATATTGGTAGCAACATCATCAGCAACA
      TCGATCAGAGCAGCAGCTGCAGCAGCAGTATGTTGCTGAGTGCCACGAGCAACAGCAACATCGGCGGCGGCAGCAGCAGC
      AGCAGCAGCAGCAGCAGCAGCACCACCTTGCCTGCCTGCAGCAGCGCTACGACAACAACTACAGCGTCAGCGTTGACTAC
      CAGTAGAGGCCCAGTGAAAAATGTGACCCCCAACAACAGCAACAGTAGCGGCCACACCAGCACCAACAGTTGCAGGAGCA
      GCAACAACAGCAACAACAGCAGTAACAGCAGCTGTCAGACGATTGAGATGACCTCATGGGCAACAGCAGCAACCAACACG
      ACAAGCACGACGGCGACAACCGCCACAACAGGCACCCAGTGCCAGATGCTGGTGAAGACGGAGCTGAAGGGCGAGAATCC
      TCAGGTTACCAAAATGCAGTACGAGGCGCACGTAATGCCGCCGCCCACTCCGCCGGAAAGCTATTGTGCCAGTGACGAGA
      AGCTGCTCGATGACCAGGAGCAGGAGGCCGAGCTGGAGCTCCGCCTGCGTCTGGGATTGGGCCTGGAGAAGAGTCACGGT
      GGGCAGCAGCACATCGAGGCGTACGATCTCACCTGTAGCACCCCGCCCCCAGTCACCGTGCCCCAGGCAGCAGCAGTGCC
      GCGCAAGGCGAGAATTGGCAAGAGCATGGCCAGGGAAATGGTCTATGCTGCCCAGCAGCAGCTGCTTCCGGAGAAGCAGT
      TGAAGCAGCCAAAGGAGGCGGCTGCGAAACTAGAAGCGGAACCAGAGATGCCTTTCGTACTTAAAGCGGAAATCAAAGCA
      GAGACCAAAATCAAAATCGAGCACGACGGCGAGGCGCAGGCCAGCACACATATCAGCCAACTGCCGGACCTGAAGCCCAC
      CATCAAAACGGAGCCAGAGCAGGAACTGGAGCAAGAAGCGGCATCAGTACCGTCTGTGGCCAAAACGGAACCGCAACCAG
      AAGTGGAGGTCGAGCGGGAACAACAGGAACCGCCGGTTGACGAGGAGCAACAGCCTACGCCAGGCGGTAGCAAGCAACGC
      TTCAACCTGCTGGCCTTGTCCAGCGGCAACAAAAAGACGAAAACAAACAACAGCTACAAGAGCCTGATCAAGCAGGCGGA
      GCCCAAGAGTTACCTGTGCCCCGGTCGCAGGTTCATCCGTCGACACGGACGTGCTCCGGCCAAATATGTCAAACGGCGTC
      AGATGATTCTGACGCAGCGGCAGCAGCAGCGAATGCGTCTGCAACGCCGCGAGCAACAGCAGCAACGTCGCCAGCAACGC
      GAAGCGGCTGCAGAAGTAGTTGCAGGAGCTGTTGTCACCCCATCTCTGGCAGGAAACCCCATCGAGCAGGCAGGATCAGA
      AGTTTCCATCGTTAAAGATCAAGCACCCAACAGCTCGGCCACGCCAAGTGCATCGCCGAAAAGAGCACGCCCCCGGAAAC
      AGGAGATTGCTGCTCTGCATCTGCTCGAAGGCTTGGATACGACGCTGAGTCGTGGTTACTTCAGTGACCCGGAACTGAAT
      CACAGTAGTCGCAAGCAGGCGCCGACAGCTGTGGGTGGGCTGTATGCCGCGTCCTCGCCGCTAACTACGGCGACCGATCA
      CAGGGGCAAACAGACGACTGCCGAGAAGCGCTCCAAGTCGGAGACCAAGAAGCCACCGTCGGGCGAAAGTTCCGAGTCAG
      GTCTGCCGTGCAAGAAGCCGCGCAAAGAGCCTGCTGGCAAGGTGAAGGGTAAGGGCAAGAAGACAACGGCGGGAGCAGCA
      GCGACAACAATTGCGTCCACAGCTGAAACTCAGACGGAGGCCGTAAATGCCATCACTGCATCCAACCAGGAGACGAACAA
      CAACGAGTATCAGACGGCAGATCTGCAGGCTCAAAAGTTCCGTGAGTGTCCGGCCGTCACTGATGCAAAAGTAGCGGGAA
      CAGCAACATCCACATCCACAGCCTCACAGCAGCAGAACCAGCAACATTCCGACGAGCAACACCAGTTCCTGGTGCCCAGT
      CAGCCAGCGACGGCCAGCGCCACCGCTGCCCTAGCAGCCACTCCTCCGCCCAGCCGTCAAGGTCAGGCGACACACACAAA
      GCGGACCAGATCGCGCTGCAAGTTCGGGAATCGAAAGCGCCAAAGACACAGACCTGGCGGCGTAAGCTACGAGCTGGATG
      TGACCCAGCCGCCGGCCACCAAGGCCAATGTGGTGCCCAAGTGGAACAATGGATGGATGTGGGCCGGCAAGGCGTTCCAG
      GGTGCTGTCTTTCTCAATAGCGATGATCCGCTGGTGCTGCGCACCTGCTACCCGGCCATGCGGCACGTGGAGGGCGACAT
      TATCCGCATCAGGGACTGTGTGCTGCTCAAGGCCAACGAGGACAATGAGCTGCCATACGTGGCCAAAGTGGCGCACCTCT
      GGCAGAATCCCGAGGACGGCGAGATGATGATGTCGCTGCTGTGGTACTACCGACCCGAGCATACCGATCAGGGACGGCAG
      CGCAACGATTGTCCGGACGAGGTCTATGCCTCCCGCCATCGCGATCACAACTCGGTGGCATGCGTCGAGGACAAGTGCTA
      CGTGCTCACCTTCAGCGAGTACTGCAGATATCGTCGCCGCCTACGTGCCGCCGAGGAGGATGTGGAAGACGTAAGCATTG
      TGCCGCGTCGGCCAAGCATTGCCACCGCTCCCGGGTTTCCAGTGCGAACGGTGCCGGAACACACCAATCCGGAGCTGGTG
      ATGTTCTGCCGCCGAGCCTATGAGTTCCGGACGCGACGTCTGCTCAAGCTGCCCCATAAGAACGGGCTCGTGTGCAGCTC
      CAGCTAGCGCAAGGCATGAGCCATTGCGATCGAGCTCCCGTCAACCCAGGCAATGGATGAACTGCGGAGTGTAGGAACAA
      TAGCTTAAATTCAGATTGCAGTGGGAATTGGATATTGATATGCGGAGTGGCGATGGAGAAAGCCCTGGCAGAGGGGATGG
      ACAAGGAACTACTCATAGAGAGAAAGTTACATTGTTTTGATCAGTCTACAGTATTGTTAAAGATATTTTTTGTCTTTGTT
      GTTAAGAGATATCTGCAAGGATGGGCCCCCGGGCTGTGCATCTGCATTAGTTGTTCCTAACCAAATATCGATTGCTCTTG
      TTGCGCCCGTCGTTCGATGACGCGGACACGGACACGTACACTACCTCTGTCGGGGCAGGATAAGGGACACACAGATACAC
      CCGGGACCCCAAGTATACCCAGGACACACACACACACACACACACACACAAACATACACCAGACCAAAATGTAGGCGAAG
      GCTTTTCACTTAGACGTGAGAATTTCGAGAGATGCGAGGAGAAGAGGGAAAATGTTGGGAGACAACTGCTAGGCGAAAGC
      ATTAAATACTTTACATTGTATTACATAATTTATTTATTCTGACTACACACCCCACCCCCTGCCAACCCTCACACACATGC
      GGATATTTTTGTTATTAAGTTGTATGTATTTATTATCATTAATATCGAGTAAGTCAGCATTCTGTGTACAGTTTTCCGCT
      CGCTTTTGCTCTAATCGCTCAAGGAATTGGTTTAACCACCTACCGAAAACCACATCCATTAGCTAAGACCCTTTCGATGG
      CCAAAAAGTTATTTGGTGTGCCACAGAAATCTCTGCAAATCGACTTGATGCGATTTTAATTGTCTTTTCCTCAAAACTAA
      ATCCATTTGCTCTGTAGAGATCACTGCGGCTCTCCGAATAAGAACAAGCTTTCAACTTTTTTTTTTTTTTTAAACTAAAA
      AGTGTTCGGATAGTCGTTGAAATAGTTTTTTTATTTTGGTATAACCGATTTTTAAATCGCCAAATCGAGTCTACCGACTT
      TAAATTGTAATGATTATCGTGCATGCCTAATAAAGAACTTGGAATATTCCGATAAATATTTTAGGAATAGCTGAATTAAC
      CATTATTTTATATACTTGACCAACGGTTTCCACTTTTTCCATTTACACTCTAAATGAGATATCCTTCTCTGTCGTTTAAT
      TTTCGATAGATTCAGATGCATGAAAGACCAGGCTTAACCCATTGATGGCCAGGCAAAAAACTTTGCGCACAGACAAAACC
      AATCTAACTATAATTTCTGACATATTTGAGATTTCTGGCTCCAGAGGCGGAAAACTGGATGGCTTGACATCGATCCTTGC
      TAGGCGCTGTTGGTATATATTTTTATTTGTTGTTAGTTTTTGTAAGCGATTGAACACACATTTTGTACTCTTGATTTGAC
      ATTTATCTTTTGTGTTCGCCTTAGTTTGGAAATTTGATTTCAGAGACATGATTTTCTTTCGGTTAACTATATTATTCAGC
      TGCAAACAGTTAACGAGAATCTTTAGGGAAAATAACAACAGAAACAACAACAAGTCACATTATTATATTATATATACATA
      AATATATCTACGTAGTTCTATATAAACAAATATCCTTATCCATAAAACATTTTTTTGTAATCTTAATTTAATTTAGCAGT
      AGCGTTTTTAGTTGCTAAGTTGATATTGCAAATAGTTTGTTTTATACCAAATACAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0074800
      9826
      FBtr0074801
      5874
      FBtr0100839
      8024
      FBtr0306521
      6603
      FBtr0306522
      6524
      FBtr0306523
      5631
      FBtr0332993
      11220
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0297487
      2529
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0074569
      2529
      FBpp0074570
      1280
      FBpp0099783
      1456
      FBpp0297488
      1456
      FBpp0297489
      1456
      FBpp0297490
      1139
      FBpp0305208
      2529
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Transcriptional initiation site is supported by short-capped RNA data (FBrf0209722) and modENCODE RNA-Seq coverage data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG32529-RE
      Hers-RE
      Secondary FlyBase IDs
        References (0)