Open Close
General Information
Symbol
Dmel\Ptpmeg-RK
Species
D. melanogaster
Annotation Symbol
CG1228-RK
FlyBase ID
FBtr0306563
Feature type
Associated gene
Evidence Rank
Length (nt)
4079
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 78 )
Sequence
TCGTTTTTACAGTTCGCGGTTTCGAGGTTTGCAACGCGCAATGAGCAAACTTAAACTAATTTTGTGACTCGGTAATCAAG
TAAATGTGCAGCGGTCTAATTGAAATCAATGTTGCACGTGCAAATTACAGCTTGCGAGAGCAGCAATCATTTTTGTTCAG
TTTTTTAAAGCTTACGAGGTATGAAAAGAAGAGGAAGTAACGGCAATGCCAGAAGCTTGTTGCTTTCTCCACTCCTCTTT
CATCCTCGTCATGTGTGTGAGTGTGCAAGTGTATGTGTTTGCTAGGCTTAGAATTCCCAGTGAATATTGGGGAAATGTTA
ATTTAAAATGCAAAATATGTGATGGATAGCAAATGGATACGTACAAACAATATCAATCAGATATCCATCCACATGAAAAG
GAGCCGAGGGAGGCAGCCAAGTTAACTGGAAACAAAACATCCAGCAAGCATACTAAGCTAAGAAATATAAACACTCTTGC
CAATTTATCGAATAAACAAGAAGCCGAGCCAGGAGAGGCAGCCCGAACAAACAGGGAGCTCCTTTTCCGCCATCTGCGCC
CTCCAACGTGATACACGAAGTTTTGTAACCCTCGAACCCGACCCGAATCATGGAGTTCATGGAACTCGGTCATGTTTGAG
CGCTTCCGACTGAACAACCTGACTAGAACCTTTCGCCTGCGAGGAGGCGGCCCAGAACTGGCGCGCGACAAGAAGACCCC
GCAACGGCAGCAATGCGTCACCGTCCTATTCCTAGATGACATCACGCACACCTTTCGGATCGAGAAACGTGCGAAAGGCT
CTGAACTCCTGGATCAGGTCTTTCAGTATCTCGAGTTATCCGAAAGGGACTACTTTGGCCTACTATTTCCACAGAAGCCA
GGTGACGTCGTGAGATGGGTTGATGCTCAGAAGCAGTTTAAGAAGCAATGCAGCAGCGTTTCCCTCGACAACGATGCCGT
ACCATTATTAGAGTTTAGGGTTAAGTTTTTTGTAAGCGATCCCAGCCGACTGCAGGAGGAGTTCACACGCTACCAGTTCT
ATCTGCAGATCAAGCGCAACATTCTACTGGGCAAGCTGCCCTGCTCCAGCAACACCCAGTGCCTGCTTGCCAGCTACACT
GTGCAATCCGAGTTGGGTGACTTTAACGCATTAGAACACCAGCCGGGCTATCTGAGCGGAATGCAGCTGCTCTGCGACCA
GACAACGGAGGCGGAGCGGAAGGTTGGAGAACTGCACAAGTTGCACCGTGGGCAGCTACCGGCGGACGCGGAGTACAACT
ACCTGGAGCACGCTAAGCGATTGGAGCTATACGGGATTGACCTGCACAGGGCCACCGACTCCAACGGCAAGGAGCTGCAG
CTGGGCGTATCGGCCGTCGGACTGCTCGTCTTCCAGCATTCATTGCGCGTGAACACTTTCTCGTGGAGCAAGATGGTCAA
GGTGTCGTTCAAGCGTAAGGACTTCTTCATCCAGTTGCGCCGCGAGCCCAGCGAGAACTACGATACTTTGCTGGGCTTTG
GGATGAGCAGCCACAAGCACGCCAAGGCGCTGTGGAAGTCCTGCGTGGAGCACCACAGCTTCTTCCGCCTAAAGCGACCA
CACCGCCTCTCACGCTTCCTCAATATCAGTTTGGGTAGCAAGTTTTACTACTCTGGACGCACAGAGCTACAGGCTGTGCA
GGAGTCCAAACAGCGTGGTCGCATTCACAAGGTATTTGTGCGCTCGCCGAGCAAGCGGCTTCTGGGAGCCGCCGGCGGTG
TGGGAACGTCAGGCTCCTCGGGCGGTACGCCTATGCAGCAGCACAGCGGCTCCGAGAGCGCCAATTCCCACAACAACGGA
AAGCCAGCCGGCGCAGGAACCATACTGACCATTACAAAGACAAGCCGCCCGCACGATAACAAGGTCACCTCCAAGGAGGC
CGATTCCATGCCGCGCAAGGCGTGGGAGCAGCAGAGCGACGAGTATGACATTCAGCTCGACGTCGGTTTTATTGAACAGT
GCACCCGACGCTTCGAGTCTGCATCCCCGTCGCCCATGCCGCCCGCCTACAGCTCCGGCCAGCACAGTCCAATTCTACTG
CCAACAACCATCGCGGACGCCGTGGGTCATCAGCAGCCGGAAAGCGGCAGCGACCTCATCACCATTCGTTTGCAGGCCGA
CGAGCAGGGACGCTATGGTTTCAACGTGAAGGGTGGAGTGGATTTGAGCCTGCCCGTTCAGGTGTCAAAAGTGGTACCCC
ATACGCCCGCTGATCGTTGCACTCCGCGAGTCTGCGAGGGCGACGAGGTACTCATGATTAATGGCCGGGATGTGCACGGC
CTGCGTCACGAGCAGGTGGTGGCCATGATTCGTGATTGCCGTCATCAAGCCAGCGGCGAATTGCTACTGACGGTGCGGCC
CCAGCGCTCGGCCCCTCTGCTCCTTGAGGAGGAGCCGTTGTACCAGTACGTCCCGGAGAGCGATGAGATCGGATCACACT
CTAATCTGCTCGATGGGGATGCTTTGTTTACCCAGAGCCTGCTGCTGCTCAGCGATGGCTTGGCGTCTGGCGCCCTGTTG
GCGCAGTATGAGCTCATGTACAGGAAGAACCCGGATCTGGCCATTACTGAGGCTCGGAAGCCGGCGAACGCGCCCAAAAA
CCGATACCGAGACATATCACCATATGACTGCACCCGGGTATCTCTGGTCAACTCGCTCACAGGCGACTACATCAACGCCA
ACTACGTAAACATGGAGATTCCCGGCGGAGCGGTAAACCGATATATTGCCACCCAGGGACCTCTGGCCAGCACCACGACG
GACTTTTGGCGCATGGTACAGCAAGAGAGCAGTCATCTCCTGGTGATGCTAACGACCGTAATGGAGTCTGGTCGCCAGAA
ATGCCATCAGTATTGGCCGGTGACGGGTGAGGAGCTTCAGCTGGCGGAGGGATTCTCGGTGCGATGCCTTAGCGAGAAAC
CGGACGAGACAGGTAGTTTTGTCTTCCGCGAGTTTGTTCTGAAGGACAAGCACGAGCAGCGACACATCCACCACATGCAG
TACTTGGCCTGGCCAGATCACTGTGTGCCCTCCGATCCTAATCTTTTCCTAGAGTTTACGGAGCGGGTGCGTGCCGCTCG
AAACCGCACGCTCCTTCAGGAGATCGAGGAGAGTCTGAAGCAGGTGCGCCTGATGGATGCCGATGCGGATGCCGACGAGA
ACGGCGGACTGATGCGCGAGCGCAAGTGTGCGGCCAGCAACGGAGCCACTCCTGAGGACGAGACGCCGGTCTCGACAAGC
GTGCATCAGTGCATCAGTGCAGCCAATCCACCTGTGATTGTCCACTGCTCGGCGGGAATAGGACGTACTGGAGTGCTCAT
ACTGATGGACACTGCGCTGGCTTTGATGGAGGCTCGAGAACCGGTGTATCCGTTGGACATTGTGCGCACCATGCGCGATC
AGCGTGCCTGCATGGTGCAGAATGTGAGCCAGTACCGCTTCGTGTGCGAGTGCATCTGCGCCGCCTACATGAAGATCTCA
CGCAGCAGTGCGGCCATTAACGACGACGAGGATTAGGGGCAGGACCATCTAGCTACGCAATCAACAATCTTCCGCTAACA
CGCCCCAAGTTTTTCTTATTCTATACGAAGCTTCGTCTAAATCTATTTAATTTTTAGATCCCGTAGACATATGTTTAAAA
CTGATTGTATATCATTACAATTACAAAACCCGTATATTGTATTATCAACTCCGTTCATAAGGTATCCCCAAATACACACT
TATACATTATCTCTCCATCAGTTGCCGAAAGTGCTGCAAGGAACGATTCTAAATTTACAAAGCCACCACGGAATGGTTAA
CGACGTGAACCAACTACCTAATCGAAGTATACAAAGCGAAACAAATGGCAATTTATTTACACCCATCCAACGCTACGCGC
CACCCATAATTGGCGGTCGATAACAAGACGCAAAGAGCAACCGAGAATGCGAACCTTATACACTGATAGACATGAGAAGA
TAAAACTGTTAGTATTTTAGCACCAAATCAATTCATAAATGTATTTATGCTGAACAAAAATCCAATAAAATGTGTAATT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0306559
3608
FBtr0306560
4116
FBtr0306561
3596
FBtr0306562
4028
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0297518
974
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0297514
974
FBpp0297515
974
FBpp0297516
974
FBpp0297517
974
Comments

Transcript terminates at site supported by polyadenylated cDNA.

Supported by RNA-seq data.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Ptpmeg-RK
Secondary FlyBase IDs
    References (0)