Open Close
General Information
Symbol
Dmel\Srpk79D-RK
Species
D. melanogaster
Annotation Symbol
CG11489-RK
FlyBase ID
FBtr0306596
Feature type
Associated gene
Evidence Rank
Length (nt)
3900
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 23 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CAGAACCCGGAGGGCAGACCGTCGGAGAGTTCGAGCCAAGTGCGGACAAAGAAGACTTTTCCGTGCTGCTGCTTCTGCCA
        AAAACACAAAGTGGAAAATGTGATGTGTTCGCTTTATTTGTCGAGGATAAATCAATTCCGCTATTAACTAGACTACGGGC
        ACGTACCTGGCCAAAAGCATCGAAGAAAGGCGAAAGGGAATCCAATAGGCCCAATTGAGGGCAGACCGTGGAAAAACCCT
        CTTCTATCGCGAACCAGTTCGTGGCAGTGTGTGCGTGCGTGTGTGGATTTTCGCCTTACTTTTTTCATGCGCAATTTGGG
        TTACAAAGCGAGAAAAGCGCTGCTTAAAATGCATGTTTTAAGCGCGTCCCTTCATTGATTTTCCTACGCACAAGGAATGA
        TATACGAAGTCCTCACCAGGAACAAAGGGCGCAGGCCAACGATGAGGACAAAGACGCGAGGAAGCTGCTTCTAGCTTCCC
        AGCATTCATTAGGACAGGGCGAGGACCAGCCCCGCGCAGATCAGGAAACTCATCCCGGGAGGCATCCTGGCTCCCGTACT
        GCCCAGTAGCGGCATGGCCGGCCTCATCGGTGCCGCAAATGGCAAACACCACCACCCACACCTCATCTCGCCCACCCACA
        CGTCACTGCCGGCCGGCATATGTAGTAGTGACAGCGGCATCTCCACTTTGAGTGCCATCTCGCCGCCACTCTCCACCTCG
        ACCACCACGGCCTCCGGTGCAGGCGGAGGAGTGGGCGGCAGCCCTCAGCTGCGCACCTCACCTGCGCTGAGTATGCTGGG
        TAGCGCCACGGCGACGGCCAGCGGCGTTACCGCCTCCTCAGGATGCGGTCTAACTGCCGGGATCCTGGGCCCGGCGGCCA
        GCATTGACCTGGGCAGCTCGCCGCTTTCTCACCGAAACTACAGCAACTCACTGAAGGGCTTTAGTTTCCGTCGCAGCTTC
        GACGACAAGATCATCAATACGCCGTACTTGTCGCGCGCTCCAGCCTACACCCACGGCATTCCCTATCCGCATTTTCACGG
        TACTCAGCCTGCGGCCACCACGCCGCACCACCTCCACCTACACCACCATGGGAACGGCACAGCTGCGGGATCAGGTTCCG
        GTGTGGGATCGGGACCGGGATCTGGCAGCGGTGCAGGAGGACTCTACCAGCAGCCTCTGTCGCTGGCCTCGATGACAGCG
        GCCCTGCCACTGGCTCCGCTCTATGGATCCCCGCTGTCCCTGCCGCTGACCTCCTCTCAGTCCACCACCAAGCTCTCCTA
        CCGCGACGACTTTCTGCAGCAGATTGGCTATCTGCCAACTACGCGCATCTACAGCACCCCGACCAGCATCGTCGACGAGG
        ACAAGGCCCAGCAGGACTTCCTCTCGCTGTCGCTGTCGCCGCCGCTCAACCGACGGCGGGATATGCCGGCACTGCGCGGC
        CCATTCGTCAGTCTATCGGAGCCCCGGGGGACCCTCAGTACGACCGACGAAATTTACCCGGATTCGTCCGACAGCAGTCT
        TTACGTTTCAGACGAGGAGCAGGAAGACGCCTCTCAGTATTGCCGCGGTGGATACCATCCAGTAGTCATCGGAGACATAT
        TTGACAACCGGTTTCGAGTGGTCAGAAAACTGGGCTGGGGCCATTTTTCCACTGTCTGGCTATGCCGGGATCTCAAAGAT
        GAGAAGTACGTGGCCCTCAAGGTTGTTAAGAGTGCTCCGCATTACATAGAGACGGCAGCGGACGAGATCCGGCTCCTGGA
        AGCTATCCGTGACGCAGACCCCATGGACGTTAAGCGGGAGAGGATCGTGCGGCTGATGAACCACTTCACTGTGCGCGGTG
        TGAATGGAATGCACACCTGCCTGGTTTTCGAGGCCCTGGGCTGCAGCTTGTATAAGCTGATAGTGAAGAACAACTACCAG
        GGTCTGGCCATCGCTCAGGTGCGTAACATAATCCGCCAGGTTTTGGAGGGACTGGACTACCTGCACAGCAAGTGTAGCAT
        CATACACACGGACATTAAGCCGGAGAACATCCTGCTGGTGATCGATAATGCCGCCGCGATGAACCAGCAGATCGACGATG
        AGATCAACAGTCTGCGCGTGAAGGGTGTCGACTTCCCCGACTCGTACATCAGCTCCATCGAGAAGCAGACCAAGTCGCGG
        GCCAAGTGGCCACTGATCGAGCCAAATGGATCGACCAACACCAACACTAACACTAGCAATAGCACGGCGACCAATTCCAA
        TTCGTCGACTCCGCTGGCCGCCGTGATCATGTCCACGCTGGACAAGGAGGACACCACGACAACCACCTCGTCCACGCTCA
        ATTCCAACACCACATCATCGCTGGCCTCCAAGTACTCCAGTCTGTTGGGGGACAGCGAGTGCAACGGAGGCCTCGGCGGA
        TCAGCGAACATAAACAACCGCTACCGAACGGAGAAGAAAATCACTGCCAAGTCTTCTGGGGATTGCGACGAAGATGCCGA
        GTCCGACACGCTGGGCGAGCAGAGCACCTTGGCGAGCACCATGGATTCGCCCACCGATCTCGATCCCGAACCCGAACTCG
        ATTCCAAGCCCAACACCGTACCCGAGCCAAGTGAAGGACCGATCCCAGAGCAGCCCACCCCGAACTCCACCAATAGCTCC
        TGCCCCTCCCACAACACAGCCACGATAGCTAAGTCCAAGATCAACTCGAATATTCTGAGCACGTGCACGTCCTTGACATC
        GACCAACGAATACTGTTTCACCAACACGAACACCACAACAGCCTCCACACCAAGTGCCCCTCCAAGTGCCACTCCTTCCT
        CCGCCCCTGCCTTAGCCTCTGCCACGCCCCCCAGCACGTGCACGCCCTCGTTCACGCAAATAGCTCCTTCTGCAACAGCT
        CCGGCTACCAGTACAACCTGTACAACATCAGCCGAGTTCTATGATGGCGATCATAAAACAACAAGCACATCAACAACAAC
        AACATCCAATGCGATATCCTCCGCAACAACAACAACCGCGACAACGACAACAGCAATCGCTAAACTAAATGTCCATGCTA
        ATGCCATTCCTTCGCAGAACCAGAGTCAGAGTAGCCAGAACAACACCTACACGATCCAGTCGCTCATTGACAACAGCAAC
        GTTCGGGTAAAGATCGCCGACTTGGGGAACGCCTGCTACGACTACCATCACTTTACTGAGGACATTCAGACTCGCCAGTA
        TCGATCAATCGAGGTTCTTTTGGGAGCGCCGTACAATTATACCGCCGACATCTGGAGCACAGCCTGTTTGGCCTTCGAGC
        TGGCCACCGGCGACTACCTGTTCGACCCTCACGCCGGAGAGTCTTACAGTCGGGACGAGGACCACTTGGCGCATATTGTG
        GAGCTGCTGGGCTCCATACCGCAGTCGGTGATCTTCCGCGGTAAGCACGGGCTGAAGTACTTCACCAGCTATGGTAGCCT
        GAGGAACATCACCAAGCTGAAGCCCTGGAGTCTAATGAACGTGCTGGTGGAGAAGTACGACTGGGACCCGGTGGAGGCCA
        AGAAGTTCTCCGACTTTCTGCTGCCCATGCTTGAGTACAATCCGGTTATACGGGCGTCGGCAGCGGAGTGCCTGCAGCAT
        CCGTGGTTGGAGCAGGAGGAGTTCGTCTAAGAGGCTCATGGAGTGACTAGACAGCCAGAGAGACACAGGCATAGGCACAG
        CTTAACTTTTATATGCAAACAATTTGCCATAAAGAGGAGGTAGCAGGAAAATGGGATGAGGAGCTAGCATTAAAGGACTC
        GATCGAAGCACACACATTTTACACTTACGAAATGCGGACGATGTGGGGGCGTTCCGCGTCGAATTTTTTAAGCTTTTTAA
        TTTTTGTACTTGAGAGCTTTAAAATGTAATTACTAAAGAAGCGATTTTACTTTTAACGAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0078496
        3760
        FBtr0303599
        3919
        FBtr0303600
        4365
        FBtr0304724
        4206
        FBtr0306594
        3359
        FBtr0306595
        4706
        FBtr0306597
        3518
        FBtr0334748
        4765
        FBtr0334749
        3930
        FBtr0334750
        3771
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0297551
        1018
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0078148
        749
        FBpp0292632
        802
        FBpp0292633
        869
        FBpp0293266
        816
        FBpp0297549
        898
        FBpp0297550
        965
        FBpp0297552
        951
        FBpp0306789
        950
        FBpp0306790
        802
        FBpp0306791
        749
        Comments

        Supported by RNA-seq data.

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        Srpk79D-RK
        srpk79D-RK
        Secondary FlyBase IDs
          References (0)