Open Close
General Information
Symbol
Dmel\mbl-RK
Species
D. melanogaster
Annotation Symbol
CG33197-RK
FlyBase ID
FBtr0306604
Feature type
Associated gene
Evidence Rank
Length (nt)
4971
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 62 )
Sequence
TCAGTTTCGAAAAATTTTTCGATGGAAGCGGTTCTGTCAGCGGAAAAGTGAATTATACCAGAGCCTGCCTGAAAAACTCA
AGAAAACCCCATCAAAGAAATAGCAGCTCTCAGCTAAATAATAACAAACACAATACTTTCTGCTCAGTCACCGCAAACAG
AAATAATCACAATTCTGCAAAACGCCGTCATCAAAAAAGTTTTAGCCTACAACTCTAGAAACGCGGAAAAATTTGTCAAA
AATACAACTAAAAAAACAACAACGCGAGTGCACGTGTATGTGAGGTGCTCAGTAAGAGTGTTTGCGTGTGTTCGTTTCTG
TGTGTGACAGATAATAAAAGGAGAAAAAAAGAAGTTGTCGAAAGTCGTTCGTGAAAATTCAAGAAAAATAGTGCAAGCGC
TGCAGGGAAATTGTCCGGAAAAATCGCAAAATCCATTGTTTTTAGCCGGCATCTTAAAAACCAACGATAACAACAGCTTC
TGCAACAACGCGCGTGTTTAGTTCACACACACACCACGGAGCGTCGAGAAAAAAAGGTTAAAAATACATTTTCAATTCAC
CATCGGCGTAAAAGTAAAACAATAAACAAATACAAGAAAATAAAACAGCAGCCGCTTTTTCACCCAACAACAACAATTTC
AACAACTTCAACTTCGCCAGCAGCAACAACAACAAGTCAGCTGGACAACCGAAGATAATGTAAACTCAGCTTACACACAA
AAAAGCAGTAAAATATAAAATACAAAAATTAACAGCTGCGTTTATCTATAGATATATATATACACATCTATATATTTGAA
TAAGCGTTCGATTTGAATCAAAATTATAGCCCAAGCTATCAGCTACCCCCACAAGCTTTGTACTCCACAAAAACGCTAAC
GAGCAAAATCGATAAAGACCAGATAGCAAATGAAATCATACCATCTGCCATAGATCTATGCTATAAACATATATAGGTGC
TGATCTGTGCTCTTGAATTTAGTGTTTTTTGTGTGTGCGTGTCGCGAGAGGAGCACTCAAAACCAAAAAAAAAAAAAAAA
ACGTATAGTAAAACAAAAAACTATCTCTAGTCGCTAGGCTATAACTATACAAACTCCAGCTATCCCAGATCCAGATCCGT
AAACAGCAAATAGTTATATATCTATAACCCCAAAATACGATGGCCAACGTTGTCAATATGAACAGCCTGCTCAACGGCAA
GGATTCGCGCTGGCTGCAATTGGAGGTCTGTCGCGAGTTCCAGCGCAACAAATGCTCGCGCCAGGACACCGAATGCAAGT
TCGCCCATCCCCCGGCCAACGTGGAGGTCCAGAACGGCAAGGTCACCGCCTGCTACGACAGCATCAAGGGCCGCTGTAAT
CGTGATAAACCGCCGTGCAAATACTTTCATCCACCACAGCATCTGAAGGATCAGTTATTGATAAATGGACGCAATCATTT
GGCCCTCAAGAATGCACTGATGCAACAGATGGGCATCGCGCCCGGCCAACCGGTCATATCGGGCCAAGTGCCAGCCGTGG
CAACAAACCCCTATCTGACCGGCATTCCGGCCAACTCGTACAGTCCGTACTACACAACGGGACACCTGGTGCCCGCCTTG
CTGGGTCCGGATCCCGTGACCTCCCAACTGGGACCCGTGGTGCCCCAAACAGTGCAGGTGGCACAGCAGAAAATACCACG
TTCCGACAGATTAGAGATGGATGTTAAAACGGTTGGTTCATTTTACTATGACAACTTCCAATTCTCTGGCATGGTACCGT
TCAAACGTCCAGCTGCCGAAAAGTCTGGCATTCCAGTTTATCAGCCCGGTGCGACCGCCTATCAGCAGCTAATGCAGCCC
TACGTGCCAGTCTCATGTATCATAAACGCTGTTATGGCTTCTACCAATATAACATCATCAGCAACAACAACAGCATCATC
ATCATTACTATCAGCGTTGGGCACACCACCAACGACAACAACAACAGCCATTACTAATCCTAACGATAGTGATAACGATT
CCGATCGCAATCAAGACCATGACAAAAATCACGATAGTACTGCTGATGGTGAAGCTGATAATGCCGATCGCAACGATGCC
ATTGATCAAGTCAGCAATCAAGACAATAGTGACCAAGTGAATCTGAATCAGAATCAGCAAAATTCAAGTCCCGCTAAAGA
TTGTAATACAACACGAACAATCTCACCAAATCCCCAAGACACAGCAGCAACAGCTGCCACTGCAACAGAAACAGACACAC
TAGATACAGAATCTGCAGCAGCAGCAGCAGCAGCAACATCTGCCACCCATCCCCCTGGCGACACACCGCCCCCTTGCCAA
CGTTCGCCCCAAGGCGATAGTCTTCTCCCCCTGCCCAATGGCCTGGGCGATAATAACAATTACTTGTCCTATATCAATAA
CAATCTTAACAATGGTCAGCTCAAGTCGGCTAATCCCGAAGAATTGAACGGTGGCGACTTAGAGAGTAGCAGCAATAACG
CAGCAGCCGCAGCCGCAGCATCAGCATCAGCATCACGTAACTATGCCAAGCAGAATGGCGAGGGATATTCGAGGTATATG
GTTAATGGTCATAGCACTGGCATTCTGCCAACACCCACAACTTCTGCTCCGGCAGTTTCCTATCAGGCTCAGGCTCAAGC
CCAGGCCCAAGCTCAGGTTCAGGCCCAGGCCCAGGCACAGGCCCAAGTTCAGGCCCAGACTCAGCAGCGCATCAACTATG
CCATGTCCGCCTATGGTAATCTGTACTCCCACTACGGAGCACCGACCTCTGCCATGGTGAGTCTGCCCAGCAGCACTCCC
TCCTACGCCCAGGCTCAAATGCAGCAGCAGCAACAACAGGCGCAGGCTCAAGCTCAGGCGCAGGCTCAAGCCCATGCTGT
CTATGCCCAGCAGGCCTACGCCGCCTATGCCGCAGCCGGTTTGGCACCTCAGGCCACCGCTACAGGTAGCTACTACGCCG
ATCCGGCTGCCCTGGCCAAGGAGGTGGCCCAGAAAAACTACGCCATGAAGCTGGCCAGTGCGGGCACAAAGCCGGGTGTC
TCCTCGGCGGCCGCTGCCTACACCGGCTTGACACTCAACAAGAGCTATGTGGCCGCAGCAGCTGGTGCACAGCCTGTTCA
GCCCGCCCAGCATCAAGCCGTTTCCATGGCAACACTACTGCAAATGCAGGCTCAGGCCCAGGCGCAGGCAGCACAAGTTC
AGGCCCAAGCTCAGGCTCAAGCTCAAGCTCAAGCTCAGGCCCAGGCTCAGGCCCAAATGCGCCAGTTGGGTTCCCTGCCC
AGTTCAGGACTAGCGACTCCTGTGCCCGGCACCCCAGTGCGTGCCCCAGTCGGTGCCAGTCAGTATCAATCGGCTACGCT
ATTGAGAGCACCCTCACCTATGCCATATGCGCAGCCACAGAGCTACTTCTATCCCGGAATGATGCCCACCGCAGCCTATG
CCATGCCACAGACTCAGGCCGCTGCTGCCCAGCAATATGCAGCTGCTGCAGCAGCAGCAGCAGCCGCTCAGGCGGGAACC
CCAGGCAGTGCCATGGTCCTAAATCCCTACAAAAAGATGAAGACCTCCTAAGAACCCGGGCGATAACAATCTAAAAGTCC
AAACACAACTGTACTTAATGCACCAAGCCATCGAACAGATGGAATAGTCACACCATTTTAGATTTATAGATATAAACACA
TCGAAGACGTAAGAATATGTGCCTCAGTTTTCTTTGAAAGGACATGTAGAGAGAAACGTTTAGATCTTAGTTTTACCATA
GGCCTCATAGCGTTAGGAAACGGAACCATGACAAGATAACTAAAATCCGACAGACAGCGAGACAGATCGAAGATCAATGC
TTACTAACCCAAATGCCCAAAACTTGCTGACACGAAATCGATAATTTGCCATTAAGTTATTTCACAAACGAAACATAACC
TCACTGTGACTCAAGTGTTGCCATTTTCGCAAATGAATCGAAAAACCGAGCTTTTAAAGCACAAGCGAACGGAAGAGAAA
CAGATGTTAGATGATAGTAATACTTAAGTTCCTTTTTTGAATAGCTCTTAGTTAACTCTAGTTTATAGGAAACGGTCACA
CAAAACGGATAGAAAAAAACTTAAAACGGGGGCGGGCCAGAGAAAGAAACGAAGAACTGTGATAGCTAAAAAGCTTTGAG
GGATCAAAATCATTAAGCCAGAAAGGAGTTTAAAAAAGGATAAACCTCTAATGCTGCTGCCGATGCTGGGTACAGTTGTG
TATGCTTGTTGCTAGCTGCGGGTGCTTAATGCCATATTGCCGTCCCTGTCTCCCAAATGCGGTAGTTCGAATAGCTGTCT
TTCTCTCGCCCCCGTCCATCATTCATTTTTCGCGCTCTCTCTCTCTCTATCTAACTCCCTATTGCTGTTTCTTAATATTT
CCTTACTAGCTAGATAGCTAGCGTGAATGCTGTTGTAATTGTTTAAAATTGTTGAGCAACGATTATTGCGTAACGAATAT
TGTCTAGATTATATAGAATACTTATACGATATACAAATACATATAAACCTAGGTGTACGTGCTGTATGCTGCTACCCATA
TTCGATACAATATATACACCCACACTATGTACTCTAACACACGCTCATCCCCCACTAGTACACAAAAGAAAAAAGGCATT
ATAATGACCAGGATCTATCTGTAAATCGTATGTCTAGCTTACTAATCAGATATTACAGTACAGTCACCACTCACGATCAC
GTCTCTCTATCTGTTTCACTCACACACCAGATACCCAAACACTTTTCAGACTGTTAAGCCAGCAAAATTAATTTATGTTA
ATGTTATGTTATCGAGATTTAAATTTGATGTGTTGACCAGAACTATGTAAACCCTTTTGATTTTCAAAGACTATCTCCAT
ATCCTGATTTCATTTTTCACCTGTTCCTTAACAACTATCACCCACTCTATCGATGTATTATAAATGTTTTCCTTTTTGTA
ATGGAATTGTT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0086991
2942
FBtr0086992
3877
FBtr0086994
7500
FBtr0306601
5257
FBtr0306603
4929
FBtr0306606
5023
FBtr0310058
7373
FBtr0310059
7517
FBtr0310346
7651
FBtr0336940
5430
FBtr0336941
5337
FBtr0336942
5379
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0297559
803
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0086143
203
FBpp0086144
297
FBpp0086146
243
FBpp0297556
951
FBpp0297558
789
FBpp0297561
873
FBpp0301759
535
FBpp0301760
583
FBpp0302029
667
FBpp0307871
956
FBpp0307872
925
FBpp0307873
939
Comments
3' UTR based on RNA-Seq data.
External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
mbl-RK
Secondary FlyBase IDs
    References (0)