Open Close
General Information
Symbol
Dmel\cnc-RD
Species
D. melanogaster
Annotation Symbol
CG43286-RD
FlyBase ID
FBtr0306746
Feature type
Associated gene
Evidence Rank
Length (nt)
3570
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 65 )
Sequence
GGAAAACTTGTCAGCTGATAACACCCAAAGTATATACTTGGGTTATGAACTTAGGTCGATTATTTTCAAGTAGTAGTACG
TGATTATACTAAGGCTTCTGTCGCATGGTTGACAACAGCACTAGCAACAACTCCTCGGTTCTGGGCTTGCCCAGCAGTGG
ACATGTTAGCAACGGCTCCGGTAGCTCGGCACAACTTGGGGCGGGAAATCCGCACGGTAACCAGGCCAACGGAGCGTCCG
GCGGCGTTGGCTCAATGAGCGGATCAGCTGTGGGCGCTGGAGCTACGGGAATGACCGCCGATCTCTTGGCAAGCGGCGGT
GCAGGAGCACAAGGCGGTGCGGATCGCTTGGACGCGTCCAGCGACAGTGCTGTCAGTTCGATGGGCTCCGAGCGAGTGCC
GTCCCTCTCCGACGGCGAGTGGGGTGAGGGCAGTGACTCCGCCCAGGATTACCATCAGGGCAAGTACGGAGGCCCCTACG
ACTTCAGCTACAACAATAATTCACGGCTTAGCACCGCCACACGTCAGCCGCCGGTGGCGCAGAAGAAGCATCAGCTGTAC
GGCAAGAGGGATCCCCATAAGCAGACGCCATCGGCTTTGCCACCAACAGCTCCACCAGCAGCCGCGACTGCAGTCCAATC
GCAGAGTATCAAGTACGAGTACGATGCTGGGTACGCCTCCTCGGGAATGGCCAGCGGTGGAATCAGTGAGCCAGGAGCGA
TGGGACCCGCTCTATCCAAGGACTATCATCATCATCAGCCTTACGGCATGGGAGCCAGCGGCAGCGCCTTTTCCGGCGAC
TATACAGTACGACCATCGCCAAGGACTTCGCAGGATTTGGTGCAACTAAATCATACCTACTCGCTACCCCAGGGAAGTGG
ATCCCTTCCCAGACCCCAGGCACGCGATAAGAAGCCCCTGGTCGCCACTAAAACCGCATCGAAGGGAGCGAGTGCCGGCA
ACAGCAGCAGTGTTGGCGGAAACAGCAGCAACTTGGAGGAAGAGCATCTGACACGCGATGAAAAGCGCGCTCGATCCCTG
AACATACCCATTTCAGTGCCGGACATCATTAACCTGCCCATGGACGAGTTCAACGAGCGCTTGTCGAAGTACGACCTTAG
CGAGAACCAGTTGTCGCTGATTCGCGACATTCGTCGGCGTGGAAAGAACAAGGTCGCTGCCCAGAATTGCAGGAAACGCA
AATTGGACCAGATCCTGACTCTAGAGGATGAGGTGAACGCGGTGGTTAAGCGCAAGACCCAACTTAATCAGGACCGCGAT
CATTTGGAGAGCGAACGCAAGCGCATCTCGAACAAGTTTGCCATGCTGCATCGTCATGTCTTCCAGTACCTACGGGATCC
CGAGGGAAATCCCTGCTCGCCGGCGGACTACAGTTTGCAACAGGCTGCCGATGGCTCCGTCTACTTGCTACCACGTGAAA
AGTCCGAGGGTAACAACACGGCTACAGCTGCCTCCAATGCTGTTTCGTCGGCCAGTGGGGGAAGTCTTAATGGCCACGTG
CCCACTCAGGCTCCCATGCACAGCCATCAGAGCCACGGAATGCAGGCGCAACATGTTGTCGGTGGGATGTCGCAGCAGCA
GCAACAGCAGTCGAGGCTGCCTCCACACCTGCAACAGCAGCATCATCTGCAGTCGCAGCAACAGCAGCCGGGAGGTCAGC
AGCAACAGCAGCACCGCAAGGAATGAAAGTACCTGTTGCGAATTGCCGCAACTAAGAGTTGGTTCACTAGTTTCCAGCGC
GGGCAGCAGCATCGATCCGTGCAGCAGCAACAGCAACAGTTTGATTACCGCTACGATATGATGAACAACAGTTATCTGTA
CTACTGAGCGGCGATTTGGATATTCTACTTCTTGTTTTAGATGCCACATGTTGCTGGCAACATTTGTTGCACCCGCTGCT
TTCGGCCCATTGGAGCTCTTTCATTTATCGCACCAATCCTCCCATTAATGGTTTACTCATTTAGTCAGCATGATTGTTAT
TTATTTTTTAATTAATTGATTATTTGGACTCGTCCAAGTCCGTCTTGCATGGTGTTGTCCCTTCTGGACAGCGTATGCGA
AGCCTTTTACTTAATTGCAATTAATGAAAAACAAAACTTGTGATAAAACAGCTCTTTTACTCCGAAATATTTGCGCCCCA
AAGGTCAAGCTGACAGAAAAATGTGCGAAAACAAACAGATCCGAAAAGAATGTAATTAAAAATGCTTCACATGAATTTGT
AAATCAGTAAACAACTCACATTCAGAACCAATCCCACTTATCCATTATTCATCGTCGCGTCGTCCAACAATATTTGATGG
TGAAACCGTTTACATCTCTATAATATTAGCTTGTAAAATATGAAAACACAAAGATGGATGCAGAGAAAAATGTATAAAAT
AGACGATAGGAAAATACACACACACACAAAACTATTGTAAAGGTTGAAAATATTGCTGGACATTTCATGAATTACGGGCG
TAAGACATTTACATTTGTAAGCTATATTCTAGTGAAAGATCTACCACAGCGGTGAATAGTTGTAAATCGTTCTAAACTCA
TAAGGCATTTATCAAAATCCCATACACAAAAAATAACACAAATTATCACTTTCGAGCTAGCACACAGCATCTGTAAATAC
ATAATTTAAACTTAGCTAACATTTAATAAACCAGCGCTAGGCTAAAGCAACAATGAGTGTGCTAACACACCTCAAAGAAA
CTAAAGAAAATACTAAACAAAAAAAAAAAAAAAAAGGGAAAGAATCGAAAAATTTTAAACAAAAATAATTGCTCTTGCTA
GAGCGTCCCGTTAACTGTCTTTAAAACGGTTTAGTAGATAAGCGATTAAGAAATATTAATATTTAATATTCTTAAAAATG
TCCTACAGCATAAAGAGTTAAACTTTAAACTAAGCCACAGCTACAGATACGATATCAACCTAAGCAAATCCGATACGAAA
ACAAAACATGGATCTATTGTTAATATAGGCATATGTATTTTAATTGTTGTAATGAATTTCGCGCACATTTGAAAGTCGAT
TGTTGCAAGTCGAAATCGAAAACTACGAAATTCAATAAAAAGCGCAACTTTAATAAAAAGATTATTTGTTGTAAATTGAA
ATTGAACTAATTACCTACTATTGTACTACTACGCCTACGGACATAAAAAATACATTAAAAGAAACCCTTCGCGTATTCTA
TTAACATAAAATTTGGTAAGAGGAGTGTTTAGATACCAAGAATATCCTTGATATGCTATCAAAAGCTTCCAAGGATCTCT
GACCACCTTTGACCAATCCCTGTACTTGTATGTCGCTATATATTTGTGTATGTTTCATATGAGAAATTTGTATGCTTTAA
AAATGATAAACTTTCCCTCAGCTAAACAAAGAACGTCAAAATTAAAGAAAAAAACACTACAAAAATATATAAAACTGTCT
TTCATTGGATTCATATTATGCACTACCCGGGAGTATTCCAAATAAAACGCATCGGTTAGATTCTTTTCATTCCATTTTAT
GGTATAATTCACCGTCTTTCATTTGCACAATCTGGGCGAAGCTTAAAAAT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0306747
3477
FBtr0306749
5180
FBtr0306748
6701
FBtr0306745
3550
FBtr0306744
3575
FBtr0306750
3921
FBtr0306751
3552
FBtr0306752
4750
FBtr0306753
6785
FBtr0306754
6954
FBtr0306755
5119
FBtr0308226
4737
FBtr0308227
4746
FBtr0330372
6701
FBtr0336455
4261
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0297669
533
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0297670
533
FBpp0297672
805
FBpp0297671
1383
FBpp0297668
533
FBpp0297667
533
FBpp0297673
533
FBpp0297674
533
FBpp0297675
1133
FBpp0297676
1383
FBpp0297677
1383
FBpp0297678
1046
FBpp0300546
1133
FBpp0300547
1133
FBpp0303398
1430
FBpp0307561
711
Comments

Extended 3' UTR based on RNA-Seq and cDNA data.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG43286-RD
cnc-RD
Secondary FlyBase IDs
  • FBtr0084397
References (0)