Open Close
General Information
Symbol
Dmel\Dscam1-RBP
Species
D. melanogaster
Annotation Symbol
CG17800-RBP
FlyBase ID
FBtr0306780
Feature type
Associated gene
Evidence Rank
Length (nt)
7708
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 45 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AGAACCGGATTTCAGCGCTAGTCGGCGAATCGCGAGAGCGTGCGAGTATTTGTGTGTGCGTGTGAGCGTTTGTTTTGGGA
      CACCGATACGGATACGGGTACGGATAGACGGATATACGGCAGCGGTACGCGATTAGCAATCCGCCAACCGGTTGCAGCGG
      TGCTAGTGCACCACCCTACAAAAAAGTGAATAATAGTATGCAAAGTATCTGAAAGATAGTCAAGAGCAGAGCAAAGTATC
      TGTGTTTGTGTGTGCCGTGCTTTTGTGCGGAGTCGCCACCCCCGTGGATTAGTGGCACCCTGCTGCAAATAGCCCACCAC
      TCTCACAAGTGTGTGTGTGTGAGTGTTAACAATTAATCGCATTTAAAAAACAATTTGGCCAGCCGCAGTAACAATAACGA
      TAATTCGGACGTGCCAAGGGTGCTTTTCAGTGGATTTTTGCGTAAAATCGATAGTCAGATAGACCCGCTCTCTACTGCCA
      ACTTCACACAACCCGCTCAGCGGAAACACGGCATACGAAATGAATATGCCCAACGAACGCCTCAAATGGCTAATGCTGTT
      CGCAGCTGTTGCCCTCATTGCTTGTGGTAGTCAGACCCTAGCTGCCAATCCCCCAGATGCCGACCAAAAAGGACCCGTCT
      TCCTCAAGGAACCCACCAACCGCATTGACTTCTCCAACTCCACGGGCGCAGAGATCGAGTGCAAGGCCAGCGGCAATCCC
      ATGCCCGAGATTATTTGGATCAGGAGCGACGGTACCGCCGTGGGTGATGTGCCCGGATTGCGTCAGATCTCATCCGACGG
      CAAGCTGGTCTTCCCTCCATTCCGCGCCGAGGACTACCGCCAGGAGGTCCATGCCCAGGTGTACGCCTGCCTGGCCCGCA
      ACCAGTTCGGATCCATTATCTCCCGGGACGTCCATGTGCGAGCCGTGGTCATCCAAAGCTATGAATCGGAGGCGGACAAT
      GAGTACGTCATTAGGGGCAACTCTGTGGTGATGAAGTGCGAGATTCCCTCCTACGTGGCCGACTTCGTGTTCGTCGATCT
      CTGGCTGGACTCGGAGGGTCGCAACTACTATCCGAACAATGCCGCAGAGACGGATGGAAAGTACCTGGTATTGCCCTCTG
      GAGAGCTGCACATCCGTGAGGTTGGACCCGAGGACGGATACAAGAGCTACCAGTGCCGAACCAAACATCGTCTGACCGGA
      GAAACCCGATTAAGTGCCACAAAAGGACGATTGGTCATCACAGAGCCCATTGGTGCCAGAGCACCTTCCTTCTCCTCCGA
      TTACAACTCCTTCTCCTATGCCCGCGTTGTTGATCAGAGTTTTGCGATGCTTTGCCAGGCGCAGGCTTTTCCACTGCCCA
      TAATGAGATGGTACAAGTTCATCGAAGGAACAACCCGTAAACAAGCTGTGGTGCTAAATGACCGTGTGAAGCAGGTCTCT
      GGTACTCTCATTATTAAGGACGCAGTAGTCGAGGACTCCGGAAAATACCTGTGCGTGGTGAACAATTCCGTGGGAGGCGA
      AAGCGTTGAGACTGTGCTTACCGTCACTGCCCCCCTATCCGCTAAGATCGATCCTCCCACACAGACAGTTGACTTCGGAC
      GCCCCGCCGTATTCACTTGCCAGTACACTGGAAATCCCATCAAGACCGTTAGCTGGATGAAGGACGGCAAGGCTATCGGA
      CACAGCGAACCCGTGCTGCGCATCGAATCCGTGAAGAAGGAGGACAAGGGCATGTACCAGTGCTTCGTAAGAAACGACCA
      GGAATCGGCGGAGGCGAGTGCTGAGCTGAAGCTCGGAGGCCGTTTCGATCCCCCCGTCATCCGACAGGCCTTCCAGGAAG
      AGACCATGGAACCCGGACCAAGTGTATTCCTCAAGTGCGTCGCCGGCGGAAACCCCACGCCCGAAATTTCCTGGGAACTC
      GACGGCAAGAAAATCGCCAACAACGATCGCTATCAGGTCGGACAGTATGTGACGGTCAACGGAGATGTGGTTTCCTATCT
      GAACATAACCTCGGTCCACGCCAACGATGGCGGTCTCTACAAGTGCATAGCCAAGAGCAAAGTGGGCGTGGCCGAACACT
      CGGCCAAGTTGAATGTATATGGACTGCCCTACATCCGGCAAATGGAGAAGAAGGCAATTGTTGCTGGAGAAACCCTGATT
      GTCACATGTCCTGTAGCTGGATACCCCATCGATTCGATTGTCTGGGAGCGAGATAACCGTGCCCTGCCCATCAACCGCAA
      ACAGAAGGTCTTCCCCAACGGAACGCTGATTATCGAGAATGTGGAACGGAACTCAGACCAAGCGACCTACACTTGCGTTG
      CCAAGAATCAGGAAGGATACTCTGCTCGAGGATCTCTGGAAGTGCAAGTCATGGTGCCTCCACAAATTCGACCCTTTGAC
      TTCGGCGACGAGGCTTCCAACTCAGGCGAAACCATGGGCATTCAGTGCACGGTGATCAAGGGGGATCTGCCCATCAATAT
      TACGTGGGTTCTCAACAATCACACCCTGAACAGTGGTGACCTAGACGTGGTGATCGGTCGAATGTCCAGCAAGTCGAGCA
      CCCTGAATATCGACTACATAGCCGCCGAGCACCGTGGGGTCTACACCTGTCTGGCTCGCAATCAGGCGGGCGAGAGCAGC
      TACAGTGCTGAGTTGAAAGTCAACGTACCTCCCAGATGGATCCTCGAGCCCACCGATAAGGCCTTCGCCCAGGGATCCGA
      TGCCAAGGTTGAATGCAAGGCTGATGGCTTCCCCAAACCCCAAGTTACATGGAAGAAAGCAGTTGGCGACACCCCCGGAG
      AGTACAAGGATCTAAAGAAGAGCGACAACATCCGCGTGGAAGAGGGCACTCTGCATGTCGACAACATCCAAAAGACCAAC
      GAGGGCTACTATCTGTGCGAGGCTATCAATGGAATAGGCTCCGGCCTCTCGGCTGTGATTATGATCAGCGTTCAGGCCCC
      TCCAGAGTTCACGGAGAAGCTGCGCAACCAGACCGCCCGACGAGGAGAACCCGCCGTACTCCAGTGCGAGGCGAAGGGCG
      AGAAGCCCATTGGCATCTTGTGGAACATGAACAACATGCGACTGGACCCAAAGAACGACAATCGGTACACCATTCGTGAG
      GAGATCCTTTCCACCGGAGTTATGTCCAGTCTGTCGATCAAGCGCACCGAGAGATCCGACTCCGCCCTATTCACCTGTGT
      CGCCACTAATGCCTTTGGATCCGATGACGCCAGCATAAATATGATTGTCCAGGAAGTTCCGGAGATGCCATATGCTTTGA
      AGGTACTCGACAAATCCGGACGTTCCGTGCAGCTGAGCTGGGCGCAACCCTACGATGGCAACTCCCCTCTGGACAGGTAC
      ATCATTGAGTTTAAGCGTTCTCGTGCCTCCTGGAGCGAAATTGATCGCGTCATCGTGCCCGGACACACCACAGAAGCCCA
      AGTGCAGAAGCTCAGCCCCGCCACCACCTACAACATTCGCATCGTGGCCGAAAACGCCATCGGCACATCCCAATCCTCTG
      AAGCGGTCACTATCATCACAGCCGAAGAAGCACCCTCCGGCAAGCCCCAGAACATCAAGGTAGAACCCGTGAACCAGACC
      ACCATGCGCGTCACCTGGAAGCCACCACCACGCACCGAGTGGAACGGAGAGATCCTGGGCTACTACGTCGGCTACAAGCT
      ATCCAACACTAACTCGTCCTACGTTTTCGAGACCATCAACTTCATCACCGAGGAGGGCAAGGAGCACAACCTGGAACTGC
      AGAACCTGCGCGTGTACACCCAGTACTCCGTGGTGATCCAGGCCTTCAACAAGATCGGAGCTGGTCCACTGAGCGAAGAG
      GAGAAACAATTCACGGCCGAGGGAACGCCCAGCCAGCCACCCAGTGACACCGCCTGCACCACCTTAACTTCGCAGACCAT
      TCGCGTCGGATGGGTGAGCCCACCCCTGGAATCCGCCAACGGAGTGATCAAGACCTATAAGGTTGTCTATGCCCCCAGTG
      ACGAGTGGTATGACGAGACCAAGCGACACTATAAGAAGACGGCCTCCTCCGACACAGTCCTCCATGGCTTAAAGAAGTAC
      ACCAACTACACAATGCAGGTCCTGGCCACAACAGCCGGAGGCGATGGCGTCCGCAGCGTTCCCATCCACTGCCAAACCGA
      ACCCGATGTTCCCGAAGCACCCACTGATGTAAAGGCTCTTGTTATGGGTAACGCCGCTATCCTGGTATCCTGGCGCCCAC
      CAGCACAGCCAAACGGCATTATCACCCAGTACACCGTGTACTCCAAGGCCGAAGGCGCTGAGACTGAGACAAAGACCCAG
      AAGGTTCCCCACTACCAGATGAGTTTCGAGGCCACCGAACTGGAGAAGAACAAGCCCTACGAGTTCTGGGTGACAGCTAG
      CACCACCATTGGCGAAGGCCAGCAGTCTAAGAGCATAGTGGCCATGCCCAGCGACCAGGTGCCCGCCAAGATCGCCTCCT
      TCGACGACACCTTCACTGCCACCTTCAAGGAGGACGCCAAGATGCCCTGCCTGGCCGTTGGAGCCCCCCAACCCGAGATC
      ACATGGAAGATCAAGGGCGTCGAATTCAGTGCCAACGATCGCATGCGCGTCCTCCCCGACGGATCGCTGCTGATCAAGTC
      GGTAAATCGCCAGGATGCCGGAGACTACTCCTGCCACGCCGAGAACTCGATTGCTAAGGACTCCATCACGCACAAACTGA
      TTGTTCTGGCACCACCACAATCGCCCCACGTCACCCTCTCGGCAACCACCACTGATGCCCTGACTGTAAAGTTGAAGCCC
      CATGAGGGAGACACTGCTCCTCTGCATGGATACACCCTGCACTACAAGCCAGAATTCGGAGAATGGGAAACATCGGAAGT
      GTCTGTCGACTCACAGAAGCACAACATCGAAGGTCTCTTGTGCGGCTCCCGCTATCAGGTCTATGCCACAGGATTCAATA
      ACATTGGAGCTGGCGAAGCTTCTGACATTTTGAACACCCGGACCAAGGGACAGAAGCCCAAGCTGCCCGAGAAACCTCGC
      TTCATTGAAGTGTCGTCCAACTCGGTGTCCCTGCACTTCAAGGCCTGGAAAGATGGAGGATGCCCCATGTCGCACTTTGT
      GGTGGAGAGCAAGAAGCGCGATCAAATTGAGTGGAACCAAATTTCGAACAACGTGAAGCCCGATAACAACTACGTGGTTT
      TGGACCTGGAACCCGCCACCTGGTACAACCTCCGCATCACTGCCCACAACTCGGCTGGCTTCACTGTGGCCGAATACGAC
      TTTGCCACCTTAACCGTTACCGGAGGCACTATCGCACCCTCGCGAGATTTACCCGAGTTAAGCGCCGAGGACACGATCCG
      CATTATCCTCTCGAACCTAAACTTAGTTGTGCCCGTCGTGGCGGCTCTGCTCGTCATAATCATAGCGATAATTGTTATTT
      GTATACTGCGTAGCAAGGGCAATCACCACAAAGACGATGTAGTTTACAATCAGACAATGGGACCCGGCGCCACCCTGGAC
      AAGCGTCGTCCGGACCTGCGGGATGAGCTCGGATACATCGCCCCGCCCAACCGGAAGCTGCCCCCCGTTCCCGGATCCAA
      CTATAATACCTGTGACCGGATTAAGCGAGGCCGCGGTGGCCTCCGGTCCAACCACTCGACCTGGGACCCTCGACGCAATC
      CCAACCTGTACGAGGAGCTGAAGGCCCCGCCAGTGCCGATGCACGGCAACCATTACGGCCACGCCCACGGCAATGCCGAG
      TGCCACTACAGGCATCCAGGCATGGAAGATGAAATCTGCCCCTATGCCACGTTCCACCTGCTCGGATTCCGCGAGGAAAT
      GGACCCTACCAAGGCCATGAACTTCCAGACCTTCCCCCACCAGAACGGACACGCCGGCCCAGTTCCCGGACACGCGGGCA
      CTATGCTTCCACCAGGACATCCAGGACACGTGCACTCCCGCTCCGGATCGCAATCGATGCCTCGGGCCAATCGATACCAG
      CGAAAGAACAGCCAGGGCGGACAGTCCTCAATCTACACGCCAGCTCCCGAATACGATGATCCCGCCAACTGTGCCGAAGA
      GGACCAATATCGTCGATACACCCGCGTCAACTCGCAAGGCGGTAGCCTGTACTCCGGACCCGGACCCGAATACGACGATC
      CCGCCAACTGCGCACCCGAAGAGGATCAGTACGGCTCCCAGTACGGAGGACCCTATGGACAGCCCTATGATCACTACGGT
      TCCCGGGGATCCATGGGACGTCGTAGCATCGGCTCTGCTCGCAATCCTGGCAATGGATCACCCGAGCCTCCACCACCACC
      ACCACGCAACCACGACATGAGCAACTCCTCATTCAACGACTCCAAGGAGAGTAATGAGATCTCAGAGGCAGAGTGCGATC
      GTGACCACGGACCACGCGGAAACTACGGAGCAGTGAAGCGATCTCCACAACCGAAAGATCAGCGCACCACCGAAGAAATG
      CGCAAACTGATAGAAAGAAACGAAACCGGCCCAAAACAACTCCAACTCCAACAAGCAAATGGCGCAGGATTCACAGCCTA
      CGATACTATGGCAGTGTAATTTGTAAGCGCCCTCTGCGGCGGTGGGCGTGGCATTTTAGCTTAGTGTTTTAGGTGCATGA
      AGTGCGTGGGAGTTGAATGACACTTAGAGACACAGGACACAGATACACACAGACAGATCATCAGGACACAAGGAAAGAGA
      TAGAGAAAGAGAGGGAGTTATATACCGAATATACACGTAAAATATTCAACTACTTCGAGTAATTATAGCGAAGGAATGCA
      AGTTTCAAGAAACATATTTATATTGTCTATGCAAGCAGCAAACCAAACTTACATAAAGTATATAAGTACATTCAATGGAT
      AACTACTATAAGAGAGTGCTGGAGACACTGAAGGAAATTACTCAAGTTATTCGAGAGGAACAGAAAACGAAATCTCAAGA
      TCAAGATCATACTTACGTATTCGAACTAATTTTCAATAATGTACTTTAGTTTTAAGCGGTGTCTACCGAAATATCAGAGC
      AACAGCAACTGAGATGGATTCTTGTGTGTAAGAGGAGATGATTCGAAATCTGTTTGTGTAAACTTTTGCCATCTATGCCA
      GGAGCAGAAAACTCATCCTTTGCCTAGCCTAAGTCAAAGTCATAATATTAACTCGTCTAATTGATATATTTAGTCGTAAC
      ATATGCGTAATATGTATGATTTCTTCCTATGCATTTTATAATTCGTATGGACAGCGCACATTTGGAGTTTTGTTTGCGTT
      TTGCGTTGACTTGTGATGATTGTTAATTTACAGAGCTTTGTGAGTGAGTACTTACGATTGTGCTCATTACTCGCTTTGTT
      CTTTATTTACAGACAAGTGATTGTCCTATCTTAGTTCGCCCTTATTTTTAATTCAAAAATGCGCTTCCAACAGAACAAAT
      CGAAACTGTTCAATGCACAAATCGCAGCCACAACAATTGAATGTATTATACAAGATCCCCAGGACACCGAAAAACCAAAA
      CCCCTAACCCGAAACACAGATACACTCAAGCACGATTTATTAAACCAATTCTGATATAGACCGTTCTGAACATGAGTTAT
      ACGCATTTGAAGCTTTAAGAGAACCTGAAATTGTTTATTTCACTTCATTTGATCTATCCTAAGTTATTAGTTCATAAGTT
      GCTAAATATATGATTTTGATTTTATTTT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0089016
      7699
      FBtr0111049
      7699
      FBtr0111050
      7744
      FBtr0111051
      7744
      FBtr0111052
      7702
      FBtr0111053
      7699
      FBtr0111054
      7744
      FBtr0111055
      7747
      FBtr0111056
      7699
      FBtr0111057
      7702
      FBtr0111058
      7741
      FBtr0111059
      7747
      FBtr0111060
      7699
      FBtr0111061
      7702
      FBtr0111102
      7762
      FBtr0111062
      7747
      FBtr0111063
      7717
      FBtr0111064
      7711
      FBtr0111101
      7753
      FBtr0111065
      7753
      FBtr0111066
      7705
      FBtr0111067
      7705
      FBtr0111068
      7753
      FBtr0111069
      7753
      FBtr0111070
      7708
      FBtr0111071
      7705
      FBtr0111072
      7756
      FBtr0111073
      7756
      FBtr0111074
      7711
      FBtr0111075
      7741
      FBtr0111076
      7741
      FBtr0111077
      7744
      FBtr0111078
      7744
      FBtr0111079
      7744
      FBtr0111080
      7756
      FBtr0306773
      7741
      FBtr0306774
      7750
      FBtr0306775
      7756
      FBtr0306776
      7708
      FBtr0306777
      7735
      FBtr0306778
      7759
      FBtr0306779
      7708
      FBtr0306781
      7762
      FBtr0306782
      7747
      FBtr0306783
      7699
      FBtr0306784
      7699
      FBtr0306785
      7753
      FBtr0306786
      7759
      FBtr0306787
      7699
      FBtr0306767
      7764
      FBtr0306768
      7710
      FBtr0306769
      7755
      FBtr0089018
      7699
      FBtr0306770
      7755
      FBtr0306771
      7710
      FBtr0306772
      7755
      FBtr0334801
      9145
      FBtr0089019
      7708
      FBtr0089020
      7717
      FBtr0111081
      7744
      FBtr0111082
      7747
      FBtr0111083
      7702
      FBtr0111084
      7702
      FBtr0111085
      7699
      FBtr0111087
      7744
      FBtr0111088
      7702
      FBtr0111089
      7744
      FBtr0111092
      7690
      FBtr0111094
      7747
      FBtr0111096
      7699
      FBtr0111097
      7708
      FBtr0111098
      7744
      FBtr0111099
      7756
      FBtr0111100
      7702
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0297696
      2019
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0088088
      2016
      FBpp0110341
      2016
      FBpp0110342
      2031
      FBpp0110343
      2031
      FBpp0110344
      2017
      FBpp0110345
      2016
      FBpp0110346
      2031
      FBpp0110347
      2032
      FBpp0110348
      2016
      FBpp0110349
      2017
      FBpp0110350
      2030
      FBpp0110351
      2032
      FBpp0110352
      2016
      FBpp0110353
      2017
      FBpp0110354
      2037
      FBpp0110355
      2032
      FBpp0110356
      2022
      FBpp0110357
      2020
      FBpp0110358
      2034
      FBpp0110359
      2034
      FBpp0110360
      2018
      FBpp0110361
      2018
      FBpp0110362
      2034
      FBpp0110363
      2034
      FBpp0110364
      2019
      FBpp0110365
      2018
      FBpp0110366
      2035
      FBpp0110367
      2035
      FBpp0110368
      2020
      FBpp0110369
      2030
      FBpp0110370
      2030
      FBpp0110371
      2031
      FBpp0110372
      2031
      FBpp0110373
      2031
      FBpp0110374
      2035
      FBpp0297689
      2030
      FBpp0297690
      2033
      FBpp0297691
      2035
      FBpp0297692
      2019
      FBpp0297693
      2028
      FBpp0297694
      2036
      FBpp0297695
      2019
      FBpp0297697
      2037
      FBpp0297698
      2032
      FBpp0297699
      2016
      FBpp0297700
      2016
      FBpp0297701
      2034
      FBpp0297702
      2036
      FBpp0297703
      2016
      FBpp0297683
      2038
      FBpp0297684
      2020
      FBpp0297685
      2035
      FBpp0088090
      2016
      FBpp0297686
      2035
      FBpp0297687
      2020
      FBpp0297688
      2035
      FBpp0306847
      1947
      FBpp0088091
      2019
      FBpp0089327
      2022
      FBpp0110375
      2031
      FBpp0110376
      2032
      FBpp0110377
      2017
      FBpp0110378
      2017
      FBpp0110379
      2016
      FBpp0110381
      2031
      FBpp0110382
      2017
      FBpp0110384
      2031
      FBpp0110387
      2013
      FBpp0110389
      2032
      FBpp0110391
      2016
      FBpp0110392
      2019
      FBpp0110393
      2031
      FBpp0110394
      2035
      FBpp0110395
      2017
      Comments
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      Dscam-RBP
      Dscam1-RBP
      Secondary FlyBase IDs
        References (0)