Open Close
General Information
Symbol
Dmel\Dscam1-RBR
Species
D. melanogaster
Annotation Symbol
CG17800-RBR
FlyBase ID
FBtr0306782
Feature type
Associated gene
Evidence Rank
Length (nt)
7747
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 43 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGAACCGGATTTCAGCGCTAGTCGGCGAATCGCGAGAGCGTGCGAGTATTTGTGTGTGCGTGTGAGCGTTTGTTTTGGGA
        CACCGATACGGATACGGGTACGGATAGACGGATATACGGCAGCGGTACGCGATTAGCAATCCGCCAACCGGTTGCAGCGG
        TGCTAGTGCACCACCCTACAAAAAAGTGAATAATAGTATGCAAAGTATCTGAAAGATAGTCAAGAGCAGAGCAAAGTATC
        TGTGTTTGTGTGTGCCGTGCTTTTGTGCGGAGTCGCCACCCCCGTGGATTAGTGGCACCCTGCTGCAAATAGCCCACCAC
        TCTCACAAGTGTGTGTGTGTGAGTGTTAACAATTAATCGCATTTAAAAAACAATTTGGCCAGCCGCAGTAACAATAACGA
        TAATTCGGACGTGCCAAGGGTGCTTTTCAGTGGATTTTTGCGTAAAATCGATAGTCAGATAGACCCGCTCTCTACTGCCA
        ACTTCACACAACCCGCTCAGCGGAAACACGGCATACGAAATGAATATGCCCAACGAACGCCTCAAATGGCTAATGCTGTT
        CGCAGCTGTTGCCCTCATTGCTTGTGGTAGTCAGACCCTAGCTGCCAATCCCCCAGATGCCGACCAAAAAGGACCCGTCT
        TCCTCAAGGAACCCACCAACCGCATTGACTTCTCCAACTCCACGGGCGCAGAGATCGAGTGCAAGGCCAGCGGCAATCCC
        ATGCCCGAGATTATTTGGATCAGGAGCGACGGTACCGCCGTGGGTGATGTGCCCGGATTGCGTCAGATCTCATCCGACGG
        CAAGCTGGTCTTCCCTCCATTCCGCGCCGAGGACTACCGCCAGGAGGTCCATGCCCAGGTGTACGCCTGCCTGGCCCGCA
        ACCAGTTCGGATCCATTATCTCCCGGGACGTCCATGTGCGAGCCGTCGTTGCCCAATACTACGACACCGATGTAAATAAG
        GCCTATGTAATACGCGGCAATGCGGCGGTTCTGAAATGCGAAATCCCCTCCTTTGTGGCCGATTTTGTGAGCGTTGTCTC
        CTGGCACACCGATCAGAACGAGGACTTTCTGCCAGGCAGCGAATACGATGGAAAGTACCTGGTATTGCCCTCTGGAGAGC
        TGCACATCCGTGAGGTTGGACCCGAGGACGGATACAAGAGCTACCAGTGCCGAACCAAACATCGTCTGACCGGAGAAACC
        CGATTAAGTGCCACAAAAGGACGATTGGTCATCACAGAACCCGTTAGTGCTAAGGGACCAACTTTTGCTTCCGATATGAA
        AAGCTATACATTTGTGCGCCACTTTGGTCAGAGTTTCGCGTTACTCTGCCAGGCGCAGGCGTATCCAGTGCCATTGATAA
        GATGGTACAAGTTCATCGAAGGAACAACCCGTAAACAAGCTGTGGTGCTAAATGACCGTGTGAAGCAGGTCTCTGGTACT
        CTCATTATTAAGGACGCAGTAGTCGAGGACTCCGGAAAATACCTGTGCGTGGTGAACAATTCCGTGGGAGGCGAAAGCGT
        TGAGACTGTGCTTACCGTCACTGCCCCCCTATCCGCTAAGATCGATCCTCCCACACAGACAGTTGACTTCGGACGCCCCG
        CCGTATTCACTTGCCAGTACACTGGAAATCCCATCAAGACCGTTAGCTGGATGAAGGACGGCAAGGCTATCGGACACAGC
        GAACCCGTGCTGCGCATCGAATCCGTGAAGAAGGAGGACAAGGGCATGTACCAGTGCTTCGTAAGAAACGACCAGGAATC
        GGCGGAGGCGAGTGCTGAGCTGAAGCTCGGAGGCCGTTTCGATCCCCCCGTCATCCGACAGGCCTTCCAGGAAGAGACCA
        TGGAACCCGGACCAAGTGTATTCCTCAAGTGCGTCGCCGGCGGAAACCCCACGCCCGAAATTTCCTGGGAACTCGACGGC
        AAGAAAATCGCCAACAACGATCGCTATCAGGTCGGACAGTATGTGACGGTCAACGGAGATGTGGTTTCCTATCTGAACAT
        AACCTCGGTCCACGCCAACGATGGCGGTCTCTACAAGTGCATAGCCAAGAGCAAAGTGGGCGTGGCCGAACACTCGGCCA
        AGTTGAATGTATATGGACTGCCCTACATCCGGCAAATGGAGAAGAAGGCAATTGTTGCTGGAGAAACCCTGATTGTCACA
        TGTCCTGTAGCTGGATACCCCATCGATTCGATTGTCTGGGAGCGAGATAACCGTGCCCTGCCCATCAACCGCAAACAGAA
        GGTCTTCCCCAACGGAACGCTGATTATCGAGAATGTGGAACGGAACTCAGACCAAGCGACCTACACTTGCGTTGCCAAGA
        ATCAGGAAGGATACTCTGCTCGAGGATCTCTGGAAGTGCAAGTCATGGTTGCACCACAGATTAGCCCCTTTTCCTTCGGT
        GATGAGCCCCTAAATCGCGGAGAAGTGGCTAGTGTCAACTGCGTGGTTCCCAAAGGTGACTTGCCACTAGATATCTATTG
        GACACTAAACTCGGCTCTCATTGTAAACGGTGAAATGGGATTCACGTTAGTGCGGCTGAATAAGCGAACCAGTTCGCTGA
        ATGTTGACTCCTTGGAAGCTGTCCATCGGGGTAGCTACAAATGTATAGCTAACAATTCAGCGGGATATGCTGAATACGTT
        TCCACACTAGATGTCAACGTACCTCCCAGATGGATCCTCGAGCCCACCGATAAGGCCTTCGCCCAGGGATCCGATGCCAA
        GGTTGAATGCAAGGCTGATGGCTTCCCCAAACCCCAAGTTACATGGAAGAAAGCAGTTGGCGACACCCCCGGAGAGTACA
        AGGATCTAAAGAAGAGCGACAACATCCGCGTGGAAGAGGGCACTCTGCATGTCGACAACATCCAAAAGACCAACGAGGGC
        TACTATCTGTGCGAGGCTATCAATGGAATAGGCTCCGGCCTCTCGGCTGTGATTATGATCAGCGTTCAGGCCCCTCCAGA
        GTTCACGGAGAAGCTGCGCAACCAGACCGCCCGACGAGGAGAACCCGCCGTACTCCAGTGCGAGGCGAAGGGCGAGAAGC
        CCATTGGCATCTTGTGGAACATGAACAACATGCGACTGGACCCAAAGAACGACAATCGGTACACCATTCGTGAGGAGATC
        CTTTCCACCGGAGTTATGTCCAGTCTGTCGATCAAGCGCACCGAGAGATCCGACTCCGCCCTATTCACCTGTGTCGCCAC
        TAATGCCTTTGGATCCGATGACGCCAGCATAAATATGATTGTCCAGGAAGTTCCGGAGATGCCATATGCTTTGAAGGTAC
        TCGACAAATCCGGACGTTCCGTGCAGCTGAGCTGGGCGCAACCCTACGATGGCAACTCCCCTCTGGACAGGTACATCATT
        GAGTTTAAGCGTTCTCGTGCCTCCTGGAGCGAAATTGATCGCGTCATCGTGCCCGGACACACCACAGAAGCCCAAGTGCA
        GAAGCTCAGCCCCGCCACCACCTACAACATTCGCATCGTGGCCGAAAACGCCATCGGCACATCCCAATCCTCTGAAGCGG
        TCACTATCATCACAGCCGAAGAAGCACCCTCCGGCAAGCCCCAGAACATCAAGGTAGAACCCGTGAACCAGACCACCATG
        CGCGTCACCTGGAAGCCACCACCACGCACCGAGTGGAACGGAGAGATCCTGGGCTACTACGTCGGCTACAAGCTATCCAA
        CACTAACTCGTCCTACGTTTTCGAGACCATCAACTTCATCACCGAGGAGGGCAAGGAGCACAACCTGGAACTGCAGAACC
        TGCGCGTGTACACCCAGTACTCCGTGGTGATCCAGGCCTTCAACAAGATCGGAGCTGGTCCACTGAGCGAAGAGGAGAAA
        CAATTCACGGCCGAGGGAACGCCCAGCCAGCCACCCAGTGACACCGCCTGCACCACCTTAACTTCGCAGACCATTCGCGT
        CGGATGGGTGAGCCCACCCCTGGAATCCGCCAACGGAGTGATCAAGACCTATAAGGTTGTCTATGCCCCCAGTGACGAGT
        GGTATGACGAGACCAAGCGACACTATAAGAAGACGGCCTCCTCCGACACAGTCCTCCATGGCTTAAAGAAGTACACCAAC
        TACACAATGCAGGTCCTGGCCACAACAGCCGGAGGCGATGGCGTCCGCAGCGTTCCCATCCACTGCCAAACCGAACCCGA
        TGTTCCCGAAGCACCCACTGATGTAAAGGCTCTTGTTATGGGTAACGCCGCTATCCTGGTATCCTGGCGCCCACCAGCAC
        AGCCAAACGGCATTATCACCCAGTACACCGTGTACTCCAAGGCCGAAGGCGCTGAGACTGAGACAAAGACCCAGAAGGTT
        CCCCACTACCAGATGAGTTTCGAGGCCACCGAACTGGAGAAGAACAAGCCCTACGAGTTCTGGGTGACAGCTAGCACCAC
        CATTGGCGAAGGCCAGCAGTCTAAGAGCATAGTGGCCATGCCCAGCGACCAGGTGCCCGCCAAGATCGCCTCCTTCGACG
        ACACCTTCACTGCCACCTTCAAGGAGGACGCCAAGATGCCCTGCCTGGCCGTTGGAGCCCCCCAACCCGAGATCACATGG
        AAGATCAAGGGCGTCGAATTCAGTGCCAACGATCGCATGCGCGTCCTCCCCGACGGATCGCTGCTGATCAAGTCGGTAAA
        TCGCCAGGATGCCGGAGACTACTCCTGCCACGCCGAGAACTCGATTGCTAAGGACTCCATCACGCACAAACTGATTGTTC
        TGGCACCACCACAATCGCCCCACGTCACCCTCTCGGCAACCACCACTGATGCCCTGACTGTAAAGTTGAAGCCCCATGAG
        GGAGACACTGCTCCTCTGCATGGATACACCCTGCACTACAAGCCAGAATTCGGAGAATGGGAAACATCGGAAGTGTCTGT
        CGACTCACAGAAGCACAACATCGAAGGTCTCTTGTGCGGCTCCCGCTATCAGGTCTATGCCACAGGATTCAATAACATTG
        GAGCTGGCGAAGCTTCTGACATTTTGAACACCCGGACCAAGGGACAGAAGCCCAAGCTGCCCGAGAAACCTCGCTTCATT
        GAAGTGTCGTCCAACTCGGTGTCCCTGCACTTCAAGGCCTGGAAAGATGGAGGATGCCCCATGTCGCACTTTGTGGTGGA
        GAGCAAGAAGCGCGATCAAATTGAGTGGAACCAAATTTCGAACAACGTGAAGCCCGATAACAACTACGTGGTTTTGGACC
        TGGAACCCGCCACCTGGTACAACCTCCGCATCACTGCCCACAACTCGGCTGGCTTCACTGTGGCCGAATACGACTTTGCC
        ACCTTAACCGTTACCGGAGGCACCATTGCGCCCCTGGACGACGGATCCGGCCACGGCAACGTGCACACCCGCATCCGCCT
        GCCCGCCTGGATGCCCGAGTGGCTCGATCTCAACTTCATGGTGCCCCTAATTGCCACCGTGGTCGTGGTGGCGGTGGGCA
        TCTGCGTGGTGTGCGTGGCCCTATCTCGGAGGCGAGCGGACGACATGCGCGGCGGCCAAAAGGATGTGTACTACGATGTA
        GTTTACAATCAGACAATGGGACCCGGCGCCACCCTGGACAAGCGTCGTCCGGACCTGCGGGATGAGCTCGGATACATCGC
        CCCGCCCAACCGGAAGCTGCCCCCCGTTCCCGGATCCAACTATAATACCTGTGACCGGATTAAGCGAGGCCGCGGTGGCC
        TCCGGTCCAACCACTCGACCTGGGACCCTCGACGCAATCCCAACCTGTACGAGGAGCTGAAGGCCCCGCCAGTGCCGATG
        CACGGCAACCATTACGGCCACGCCCACGGCAATGCCGAGTGCCACTACAGGCATCCAGGCATGGAAGATGAAATCTGCCC
        CTATGCCACGTTCCACCTGCTCGGATTCCGCGAGGAAATGGACCCTACCAAGGCCATGAACTTCCAGACCTTCCCCCACC
        AGAACGGACACGCCGGCCCAGTTCCCGGACACGCGGGCACTATGCTTCCACCAGGACATCCAGGACACGTGCACTCCCGC
        TCCGGATCGCAATCGATGCCTCGGGCCAATCGATACCAGCGAAAGAACAGCCAGGGCGGACAGTCCTCAATCTACACGCC
        AGCTCCCGAATACGATGATCCCGCCAACTGTGCCGAAGAGGACCAATATCGTCGATACACCCGCGTCAACTCGCAAGGCG
        GTAGCCTGTACTCCGGACCCGGACCCGAATACGACGATCCCGCCAACTGCGCACCCGAAGAGGATCAGTACGGCTCCCAG
        TACGGAGGACCCTATGGACAGCCCTATGATCACTACGGTTCCCGGGGATCCATGGGACGTCGTAGCATCGGCTCTGCTCG
        CAATCCTGGCAATGGATCACCCGAGCCTCCACCACCACCACCACGCAACCACGACATGAGCAACTCCTCATTCAACGACT
        CCAAGGAGAGTAATGAGATCTCAGAGGCAGAGTGCGATCGTGACCACGGACCACGCGGAAACTACGGAGCAGTGAAGCGA
        TCTCCACAACCGAAAGATCAGCGCACCACCGAAGAAATGCGCAAACTGATAGAAAGAAACGAAACCGGCCCAAAACAACT
        CCAACTCCAACAAGCAAATGGCGCAGGATTCACAGCCTACGATACTATGGCAGTGTAATTTGTAAGCGCCCTCTGCGGCG
        GTGGGCGTGGCATTTTAGCTTAGTGTTTTAGGTGCATGAAGTGCGTGGGAGTTGAATGACACTTAGAGACACAGGACACA
        GATACACACAGACAGATCATCAGGACACAAGGAAAGAGATAGAGAAAGAGAGGGAGTTATATACCGAATATACACGTAAA
        ATATTCAACTACTTCGAGTAATTATAGCGAAGGAATGCAAGTTTCAAGAAACATATTTATATTGTCTATGCAAGCAGCAA
        ACCAAACTTACATAAAGTATATAAGTACATTCAATGGATAACTACTATAAGAGAGTGCTGGAGACACTGAAGGAAATTAC
        TCAAGTTATTCGAGAGGAACAGAAAACGAAATCTCAAGATCAAGATCATACTTACGTATTCGAACTAATTTTCAATAATG
        TACTTTAGTTTTAAGCGGTGTCTACCGAAATATCAGAGCAACAGCAACTGAGATGGATTCTTGTGTGTAAGAGGAGATGA
        TTCGAAATCTGTTTGTGTAAACTTTTGCCATCTATGCCAGGAGCAGAAAACTCATCCTTTGCCTAGCCTAAGTCAAAGTC
        ATAATATTAACTCGTCTAATTGATATATTTAGTCGTAACATATGCGTAATATGTATGATTTCTTCCTATGCATTTTATAA
        TTCGTATGGACAGCGCACATTTGGAGTTTTGTTTGCGTTTTGCGTTGACTTGTGATGATTGTTAATTTACAGAGCTTTGT
        GAGTGAGTACTTACGATTGTGCTCATTACTCGCTTTGTTCTTTATTTACAGACAAGTGATTGTCCTATCTTAGTTCGCCC
        TTATTTTTAATTCAAAAATGCGCTTCCAACAGAACAAATCGAAACTGTTCAATGCACAAATCGCAGCCACAACAATTGAA
        TGTATTATACAAGATCCCCAGGACACCGAAAAACCAAAACCCCTAACCCGAAACACAGATACACTCAAGCACGATTTATT
        AAACCAATTCTGATATAGACCGTTCTGAACATGAGTTATACGCATTTGAAGCTTTAAGAGAACCTGAAATTGTTTATTTC
        ACTTCATTTGATCTATCCTAAGTTATTAGTTCATAAGTTGCTAAATATATGATTTTGATTTTATTTT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0089016
        7699
        FBtr0111049
        7699
        FBtr0111050
        7744
        FBtr0111051
        7744
        FBtr0111052
        7702
        FBtr0111053
        7699
        FBtr0111054
        7744
        FBtr0111055
        7747
        FBtr0111056
        7699
        FBtr0111057
        7702
        FBtr0111058
        7741
        FBtr0111059
        7747
        FBtr0111060
        7699
        FBtr0111061
        7702
        FBtr0111102
        7762
        FBtr0111062
        7747
        FBtr0111063
        7717
        FBtr0111064
        7711
        FBtr0111101
        7753
        FBtr0111065
        7753
        FBtr0111066
        7705
        FBtr0111067
        7705
        FBtr0111068
        7753
        FBtr0111069
        7753
        FBtr0111070
        7708
        FBtr0111071
        7705
        FBtr0111072
        7756
        FBtr0111073
        7756
        FBtr0111074
        7711
        FBtr0111075
        7741
        FBtr0111076
        7741
        FBtr0111077
        7744
        FBtr0111078
        7744
        FBtr0111079
        7744
        FBtr0111080
        7756
        FBtr0306773
        7741
        FBtr0306774
        7750
        FBtr0306775
        7756
        FBtr0306776
        7708
        FBtr0306777
        7735
        FBtr0306778
        7759
        FBtr0306779
        7708
        FBtr0306780
        7708
        FBtr0306781
        7762
        FBtr0306783
        7699
        FBtr0306784
        7699
        FBtr0306785
        7753
        FBtr0306786
        7759
        FBtr0306787
        7699
        FBtr0306767
        7764
        FBtr0306768
        7710
        FBtr0306769
        7755
        FBtr0089018
        7699
        FBtr0306770
        7755
        FBtr0306771
        7710
        FBtr0306772
        7755
        FBtr0334801
        9145
        FBtr0089019
        7708
        FBtr0089020
        7717
        FBtr0111081
        7744
        FBtr0111082
        7747
        FBtr0111083
        7702
        FBtr0111084
        7702
        FBtr0111085
        7699
        FBtr0111087
        7744
        FBtr0111088
        7702
        FBtr0111089
        7744
        FBtr0111092
        7690
        FBtr0111094
        7747
        FBtr0111096
        7699
        FBtr0111097
        7708
        FBtr0111098
        7744
        FBtr0111099
        7756
        FBtr0111100
        7702
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0297698
        2032
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0088088
        2016
        FBpp0110341
        2016
        FBpp0110342
        2031
        FBpp0110343
        2031
        FBpp0110344
        2017
        FBpp0110345
        2016
        FBpp0110346
        2031
        FBpp0110347
        2032
        FBpp0110348
        2016
        FBpp0110349
        2017
        FBpp0110350
        2030
        FBpp0110351
        2032
        FBpp0110352
        2016
        FBpp0110353
        2017
        FBpp0110354
        2037
        FBpp0110355
        2032
        FBpp0110356
        2022
        FBpp0110357
        2020
        FBpp0110358
        2034
        FBpp0110359
        2034
        FBpp0110360
        2018
        FBpp0110361
        2018
        FBpp0110362
        2034
        FBpp0110363
        2034
        FBpp0110364
        2019
        FBpp0110365
        2018
        FBpp0110366
        2035
        FBpp0110367
        2035
        FBpp0110368
        2020
        FBpp0110369
        2030
        FBpp0110370
        2030
        FBpp0110371
        2031
        FBpp0110372
        2031
        FBpp0110373
        2031
        FBpp0110374
        2035
        FBpp0297689
        2030
        FBpp0297690
        2033
        FBpp0297691
        2035
        FBpp0297692
        2019
        FBpp0297693
        2028
        FBpp0297694
        2036
        FBpp0297695
        2019
        FBpp0297696
        2019
        FBpp0297697
        2037
        FBpp0297699
        2016
        FBpp0297700
        2016
        FBpp0297701
        2034
        FBpp0297702
        2036
        FBpp0297703
        2016
        FBpp0297683
        2038
        FBpp0297684
        2020
        FBpp0297685
        2035
        FBpp0088090
        2016
        FBpp0297686
        2035
        FBpp0297687
        2020
        FBpp0297688
        2035
        FBpp0306847
        1947
        FBpp0088091
        2019
        FBpp0089327
        2022
        FBpp0110375
        2031
        FBpp0110376
        2032
        FBpp0110377
        2017
        FBpp0110378
        2017
        FBpp0110379
        2016
        FBpp0110381
        2031
        FBpp0110382
        2017
        FBpp0110384
        2031
        FBpp0110387
        2013
        FBpp0110389
        2032
        FBpp0110391
        2016
        FBpp0110392
        2019
        FBpp0110393
        2031
        FBpp0110394
        2035
        FBpp0110395
        2017
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        Transcript structure (identity of variable exons 4,6, and 9) supported by FBrf0156018 (cDNA 37). The identity of alternative exon 17 was not characterized.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        Dscam-RBR
        Dscam1-RBR
        Secondary FlyBase IDs
          References (0)