Open Close
General Information
Symbol
Dmel\CG43340-RA
Species
D. melanogaster
Annotation Symbol
CG43340-RA
FlyBase ID
FBtr0306931
Feature type
Associated gene
Evidence Rank
Length (nt)
3681
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 52 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CGCAGTCGGAGTCAGCTGCTCCAATCGCCAAGTTAACTTAACTTGAAGATCGTTGGCACGGGGGGCCCTTATCCACGTGA
      TCCTAATCAGTTTGTTGTATGTTTTGTTTCAATTTGTGCGTCATGCAGTCGGGATTGTTAACGCTGTCGACGGTTTGGGC
      TTTTTGAAGATGGAGCAAGGTGATCGGCGGGCGGGCGATGGCAATTAGCGGACTGAGTTCGTGTGGCAAGCACCTGAGAA
      ACATATTGCCCGAAAAGTGATTGATAATCGTCGTTCGTAACTGCAAACAGAAATAACAAGACAAGCGAAATTTGTGTGCC
      TGAAGCGCTGGATGCGCCCCTACATCTGCCTCATGGAGCTGCCAATCAACCGACCTGGAAGCGGGAACCTGCTGCTGGGA
      CTCACCTCCGTGGTGGGTCTCATTGGAGGCGCCTATCTGCTGCAGTGTGGCGCCCAGCAGCTCTTGGGCAAACTAGCCAA
      TAAGAAGTGGAGGAAGGAGGAGTCCAGCAGCGAGGATCACGCCTGCAACGTCTGCTGTGCGGACCTGGATCTGAGCAGTG
      CCAAAAACTACGTGACATGTTGCACCTGCGAAAAATCGGTTTGCCGCGGGCCTAAATGCGCCGACTGGCGGCCCAAGGAC
      GCCAAGTGGGAGTGCCAGCTGTGCCAGAGCTCCAAGGAGTCGCTGGCCCACACCTCCTCGTGGGTGGCCGAGCAAATGTC
      CTTCAACCAGCATAAGTTTGTCTATCCGATGAGGGCTAGGAGCGAGGTGTATATACCGATTGTGGGCGATGGCAACGACA
      GCAGCATGCAATTCGAGAGCGTTAGCCAGATTGGACAAAACGCCCACATGGACGAACGGGCCAAGATCCGCGAGTACGTC
      GAGGAGATTGTGGCCGAAATGCTGGGCGGCAATTTGGACCACGTCAAAGTGGGGCAGCTGTCCAAGAGTGAGAACTATCT
      GCCGGCCATCGTAAATGGCCATACCAACAATAGTAATAATAATAATAACAACAACCATGCGGACTCCGAGCTGGCCGACC
      TCTCGCAGACCCGACTGCGCAGTCTCATCGAGACCATCATAGCGGAGACCCTGCGGAGCTCCACCCTCAGCGCCAGCGGA
      GCCGTCTCGGAGATCAGCCTGGACACCAGGTCTCACGTCTCCGATCTGGCCAATGGAAACGGGCTGAAGCGGCGCCATCG
      CACCGAGCACTACTTCGAGCCGAAGATCTACCAGGATCTGTTGGCCACAGCGGTGCTAAATAAGATTGTGGATAAGGAAG
      GGAATACAAGGCTGGCGGCGGAGAGTACGCCGGACTTGAGTGGTCGCCACATTGACGAGAATTTCAATGCCGAAGCGCTG
      AGCACCACGTCCGGAAGCTCCATTGAACCACGGAGTGATTGCAGCCTCACCGATCATGAAATCGGACTGGATAATGGCAA
      ATCCCAATCCCTGCAAACGGACTTGGAAAGGGAATCCGTGCTTAGTGACTATATAGCCGCACACATGGTGCCACTGCCGG
      ACTTTTCAGCATCCGTCACCGAATCCGAGGATGATATTGGATCCATCTCCTCGGGCATGATCGGAGATGGAAACTGGGAG
      GACAACTGGCTGTTCAAGAAGAAACGCAGCTCGGCCACTCCGAGCAGCATTGGCATGCTGGTGCCGGCACCAAGGGAGAA
      TGTACGTGCCCAGATTGGGGATAAGACCACCGACGAGGTGAGCGATCTCTCCGAGATTGGTTCGGACATCGAGGAGAGCT
      CTCTGGATCTGCTGCGATGCAATGATCTCAACGATCGTCTGCTCAGCAAGCACCTTATTGGTGGGCAAAACACCAAGATG
      GTCCTCGACGAGCTCGTAGATCGCACCAGTCTCACGTCCCACACATTGCCGGAGGAGAATGAGCCCGCATTCACAGAGAC
      AACCAATGAGTTTGTGGTATCCCCGATGGCCATGCCTTCTGATATAAAGGCGCCTTCTCCGACGCCACCTCCGCCACCAA
      TGATATTCCAGGATGACTTGTTGAACGAGGAACCAGACCACACTCCCATCGCAGGTTCCATTGCGGAACGCGAGGTGAAG
      AAGTGGTACAACGCCGTTGAAATGCCAAATAATCCGTACTCCCCGGAGGCCCTGAAGCAGCGCATCAGCGGCACCCAGGA
      GCGCTACATGGATGTGCCCAACATCAGTCCGAGTGCTGAGCAAAAGGCACTGGCTTCGGCGCTGACGGAAAATCCGGATC
      CGCCAGCGCCCAAAGCGGATTATAAGCGCTATAGCCGCGACTACTACATCAACAATGCTCCCACATCCACTGACAGCACG
      GGGGGTGGAAAGGCCGCCACAACCAGCGCAGGCGAGGATGTGGAGGACATCGTGATCAACGAGGCTCGAAAGGCAAGCCA
      AACTGCCACTGAACAGAATCCGCCGCAGGAATCGATATCGGTATACAAAGCCACGCCCGTCCAAGTCCTGGATGAGTCCC
      TGGATTCGCAATCGAATCCCTCGCTGTACTCCCTGCAAACCACGACCACAAACACAAGCGATGAATCCGATACGGTTCGC
      ATTTACGACTTTAACAAGCAGGAAACGACGGTTATCAGGGCTGCTCCAGCGGAGCAGCAGCCCAGCGAGTCCACCACTTC
      ATCCATGGAGTCCGCCCAGGGTGCTCCACCATCGGTTTCATCATCCATCGACTCATCAGTGTCCCAGAAGCGGGAGCGCC
      CTGTGGTTCTTCAGTTCGGCCCAGGCGATTCGGTGCCAACAATAGGATCGCCTGCTAGTACGCCCACGCGGGGATCCACT
      CCTCCTGCTTTTAGATTCCTGCAGCCCAAACGTCGCCTTATCGATCCCAGTCAGGTGCTATCCGTCGACGAGGATGATGT
      GCCTGAACCCACAACTCCTGCGGCTGAGAAGCCCGTCATCGAAGATGAGGTGGCCCATTCCATGCCATCTGTTAAGGCTC
      TGGCGCAGGCATTCCTCCTGACCAGCAAGCACACACAACCCCAACGAAGATGGCGGGCCAAGGTTAGAATAGCAGCCCCG
      CCAGACACTCCAGATAAGCCGAACACGTCACTGGCCAAGCGGCACAAACTGGAGCACGCCGTCTCCATGGCAGAAGTAGC
      CGATGAGTCTACGATCGCCTCGGACTTATCATCACTCGAAACGGATCCTTCTATACATTCGGAGGCCACTCCACCTATAG
      CCTCACCGGCGAGTCCTGTGCCCGTGCGCCACGGATTCCTCCGGAGCAATATTGCTTTCTTTGAGAATTTAAAGTTCAAG
      TGAATATGCGAATACAGTCTTGTTGGGTGCGACCCTTAGTTGATCTTCCCGGAGGGGAAAATTTACGACAATGGCAAAGC
      ACCAATCCGGCCATAATCCAAACCAAATCTTCGCCAAATACCATGTGCCATGGCCTCCATTTCCCAGTCGAAACATCACG
      GAAAAAAAGTACTTAAGTTCAGTTGGCCGTTAGCATGCGCCATTGTTAATTGTAGTTCGTATTTAGTATTACATAATTCT
      TATATCCATGGATACTATTTATTTAGCTCTAAGATATGTATTACGTACTTTTTTGGCGTAAGAGAAACTATCCCAACTTC
      AGCTGAATAATGTTACACCTTACCCGTACTATTGTAGTTTAAATGTTACATAATTGTACTCAATAAAACATATAGAAAAG
      C
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0306933
      3851
      FBtr0306932
      3947
      FBtr0306934
      3012
      FBtr0306935
      3544
      FBtr0306937
      3384
      FBtr0306936
      3976
      FBtr0306938
      3941
      FBtr0306939
      3248
      FBtr0306940
      3181
      FBtr0306941
      10517
      FBtr0306942
      9266
      FBtr0306943
      9424
      FBtr0331951
      3585
      FBtr0331952
      8164
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0297784
      983
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0297786
      938
      FBpp0297785
      1020
      FBpp0297787
      723
      FBpp0297788
      983
      FBpp0297790
      847
      FBpp0297789
      1020
      FBpp0297791
      968
      FBpp0297792
      723
      FBpp0297793
      723
      FBpp0297794
      3213
      FBpp0297795
      2796
      FBpp0297796
      2893
      FBpp0304284
      901
      FBpp0304285
      2544
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG43340-RA
      Secondary FlyBase IDs
      • FBtr0088914
      References (0)